GenePrediction:GLEAN_2075 Details

Name: GLEAN_2075
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:554822..559462 (+ strand)
Length: 4641
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:554822..555121 (+ strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_108:555184..556015 (+ strand)
Length: 832
Type: CDS
Source: GLEAN
Position: GCSC_108:556381..556937 (+ strand)
Length: 557
Type: CDS
Source: GLEAN
Position: GCSC_108:557000..557511 (+ strand)
Length: 512
Type: CDS
Source: GLEAN
Position: GCSC_108:557566..557616 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_108:557756..557838 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_108:558146..559002 (+ strand)
Length: 857
Type: CDS
Source: GLEAN
Position: GCSC_108:559076..559462 (+ strand)
Length: 387
>GLEAN_2075 class=GenePrediction position=GCSC_108:554822..559462 (+ strand)
ATGAAGCTCCCCACACGGCCAATCACACGATTATCGAAGCGCTGCTGCGCGCGGCTCCCGGCGGCGTGCCGGTATGCCAC
GACACAAACGACAGCAGCCGGGAGTGCGCCGGGGTCGTCGGGTCCATCGCCTTCGTCGAACCGAATCAAGATTGTCGAAG
TCGGCCCACGCGACGGGCTGCAGAACGAGAAGAAGTCGATCCCGCTGGCGACCAAGATTGAGCTGATTGAGAGGCTGGCC
AAGACAGGCGTGTCGACGATCGAGGCGGGCTCGTTTGTGGCGCCGAAGTGGGTGCCGCAGGTAAGAGACCGATGGGCCGA
GCAGGAGCCTCACGGGCGTGGTCTAACGGAAGGGGGGATCAGATGAGCAACTCGGCCGAGATCCTCGAGCATGTGCTGGC
GCACAGGGTGGCGTCGCGCGAGCCGATCTCGTACGCCTTCCTGGTGCCCAACAGCCGGGGCCTGGCGGACGCGACGGCGA
TCCTGCAGCAGCACGCGGGCGCGTTTGTGGCGTCGCTGCCGACGGCCGGTAACGCAGGTGGCGGGCCAGAGACGACATTG
TCGCCGCTGCCGGCGGTGGAGCTGGCCGTGTTTGCGGCGGCGACGGAGACGTTCTCGCGCAAGAACCTCAACTGCGACGT
GGCCACCTCGCTGGAGCGGTTCCGCGACGTGATCCGGACAGCCAAGGAGACGCAGGCAGCAGCTGACGGAGCACCACTGC
GGGTGCGGGCATACATCTCGGTCGTGCTCGGCTGTCCGTTTGAGGGCTACGACGTGGATCCGCGGCGGGTGGCAGAGCTG
GCGACAGACCTGCTCGAGATGGGGGCAGACGAGATCGCGCTGGGCGACACGACCGGCATGGGAACGGCGCCACGCACCAA
GGAGCTTCTGCGCTGCGTGACGGCGGCTGGGATCCGGCACGAGGACGTGGCGCTGCACCTGCACGACACGTACGGCCAGG
CGCTGGTCAACACGGCGGTGGCGCTGGAGCATGGGATCCGCACGTTTGACAGCGCTGTCGGCGGCTTGGGCGGCTGTCCG
TACAGTCCCGGGGCCACGGGCAACGTGGCGACAGAGAACCTGGTGTACTTTCTCGAGAGCCTGGGCATGGACACGGGCGT
CGATCTGGACGCTATGGCCGATATTGGGCAGTGGATCACGGCTGAGATCGGCAAGGCCAACGACAGCAGCGTGGGTAAGG
CCGTGCTAGGGGCACGGACGAGGGAAGGGTGAGAGGGGACGGTAGAGCTGGGCTGGACTGATTTGATTGTGTTCGTACGA
AGTACTCTGTACTATGCATGGAATGCACAGCCAGCTTACAAAACCAATGCGTCGGCAAACGTTTCCCGACAGCTAGCAGA
ATTTGCCGACGAATGCCGGAGCTACCGCTCGCAGGCGGGGTACGATCTTCGCAGCGTGAGAGTTTTCCGAAAGAGGCAAC
TGCGCTCCACAATGTCGTGCTGCTTTGTGAAGTTTTTCTACAGGTAGCTCGAGTGTCTACAAAGTTGTTTCTATCAATAC
TGCCCTTCTTGATTATCTTCTGCCGACTGTGTCTGTCAGCTGTCATCTGCCTGCCGTGCACACACAAAGCGCTTGCTCAC
GTCCCAACTACGATGCCGGCCATTCGACTGGGCACCTGCTCGCCGGCGACGGCCGACACGCCGGCAGAGACGCTGGCGAT
ACTGGAGGACTTTACGAAACGGGCGGCGGCGGAAAAGGTGGACATTTTGCTGTTTCCCGAGGCGTTTCTGGGCAGTGGGT
ATCCGCGTGGCGAGGATTTTGGCTGTGCCATTGGCAGCCGAACGCCGGCCGGCCGGGAGGCGTTTTTGCAGTACTTCCGG
CGGGCGGTGGACCTGGGCGACGTGGTGGGCGATGCGGGAGCCGGCGGAGGACGCGACTGGGTAGAGCGGCGAGGCCGGTT
TGCGGACGAGGCGGCGTCGTCGGCGGCAGGGACGGCGGGCGACGGGACGCGCGAGACATTGGAGCGGGTGGCACGCGAGA
CCGGCGTGTTCATCGTGTCGGGGGCCATTGAGCGGGCGGGTGGCAGCCTGTACTGCTCAGTGGTGTACGTGTGTCCGAAG
CGGGGGATGGTTGGGAAGCGTCGCAAGGTGCAGCCGGTGAGTGGGAGAGGGGGGAGATTGATCTGAGGAAGATGAACAGG
GATGGCTGACACAAACAGACCGGTTCGGAACGGCTGATCTGGGCAGCGGCCGGTCCGGCGACGCTGCGGGCGGTCTCGAC
AGTGATCCGCGGTGTGCGCATCAACATGGCGGCGGCGATCTGCTGGGAGAACTACATGCCGTTGCTGCGCCAGTCGCTGT
ACGCGCAGAACATCAACCTGTACCTGGCGCCGACAGCAGACGGACGCGATGCCTGGCTGGGACTGCTGCGCACCATCGGC
ACCGAAGGCCGCTGTTTCGTCGTGAGCTCCAACATGTGCACGACGGCGGAAAGCACGGAAAGCCTGGCAGCCGACGGCAC
TGCTACCACCACAGCAGAAGCAGCAGTGCCGGCAGAGGCCCGTCTCTCGCGGCTGACGACACGCGGCGGCTCGGCCGTGG
TGTCGCCGTTTGGCGACGTGATCGCGGGCCCGCAGTGGGACGACGCGCGCGGTATCGTGTTTGCCGATGTGGACTTTGAC
GACTGCATCCGCGGCCGGCTGGACATTGACATGGGGGGGAGCTACTCCCGGTGGGTTTCCCAGACTCTTTCTGCTTTGTT
TCCCGTTCTCTGCTGACCTCTCAGGAATGACTCGTTCAAGCTGTCGGTCGAGGGTCTGGACCTCAGCCCGCTGCCGTACT
GAGATAGCGTAAACGGTAACAGTTTAACGGTATAATTTTTATTGGGTCTTTTCTCCTTTATTGTTTCTATGTTTCATTGT
ATCCCCTCCACTCCGGCAGGACGGACAGGAACTGGCGAGCTGAGACGCGGCCAGCCATGGAATCGACGATAGGACGGCGC
GGGGACGGTACAGGGTCGTAGTAGTCCTTGGCGAGGAGGCTGCCGTAGGCGGCGGTGGTTGGTGATGGCGGGCGACTTGA
CGCCGACGGGAAAGGAGATGGGCGCTGTTTTGCTGTCTTTCAGGCTAAAGTGGAAGCGGTCCGTGCAACATAGCGCACCT
CCAATTCTGCCAGACTACACCGCTGTAGAATCCACCGTCGGCAGCATCGTTCCCGAATAGGAAATGCCTAACAAAAGTCA
GGACGACTGCATATCGCCACGTTCTCGGAGGGCCTTTTGCATTGTCCTTTTCCATCACCCTTTTGGTCCATGATTGTGCT
GCCGGTACGGCGGCCATGTTGGGTGCTGCCACGGGTCGGTATAGCAACAGCTGCCGCCACAGCTGCCGCTGCGCGACATC
ACTCGACCGCCTCGCTGGCAGCCGTGCTGGCGGCCGTCGAGGCGGACGATAGCGGCGTGCACGTGATCCGGTCGACGGGC
ACGAGCCCGCACGCGAATCTGGCTGTCGAGCAGCGCCTGCTGGAGCGCAGCCGCGCGGCCAGCCGGGTGTTGTTCCAGTA
CCACAACGGGCCGTGCGTGGTCATGGGGCGAAACCAGAACCCGTGGGCCGAGGTGGCCGTACGACGGCTGCGCGCGCGCG
ACGTCGCCCTAGTGCGACGGCGCAGCGGTGGTGGTGCCGTCTATCACGACGGCGGCAATGCCAACTGGAGCGTGCTCGGG
CCGTCGGCCGGCTTTGATCGGGATCGCCACGTCGTCATGGTGGCACGGGCGCTGCAGCGGCTGGGCGTGTCGTCGGCGCG
GGTGAACGAGCGGCATGACATTGTTGTGGGGGGCGTGGAGGAAGACAAAGACAGCCCGGACAGAGAGACCGCCTACAAAA
TTTCCGGCTCTGCCTACAAGCTCACCCGCCATCGTGCCCTCCACCACGGCACCTGTCTGCTTGGCACCGATCTCACTGCC
GTGTCTGGCCTGTTGCGCTCTCCTGCCGCCGCCTATGTGCTCGCCCGCGGCGTCGCCTCGGTCCGGTCGCCCGTGCGCAA
CATCGACATTGCGACGCGCGACGGCATCGCGCCGGCCGCTCGCTTCGCCGCTGCTGTCACCCGCGAGTTTGAAGCCCTCT
ACGGCCGTGCTGCCAGTCACAGCATCGTCGACGTCGACTGCGAGGCTGCTGCCGGCTTCGCCTTTGACCCGGTGTTGGCG
CGGGGATATGCCGAGTTGATGGTGCGTTTCGTCTTTCTCTTTTCTGTCCCTGTCGTCTCGTCTCGTCTCTCATTTCTCTC
GTCTCTCCCCTCAGACCCCAGAATGGATCTATGGCCAGACCCCTCAGTTCTCCTTCTCGACTCATCCCTCTGACGAGGAT
CCCCGTGACCGCCCGCCACCACCGCCTACTGTCCCTCCCAGCTTCCGACTCGCCTTTACTGCCCGTCACGGCCGCCTGCA
CGACGTCGTTCTGTCCGGCTTGCCCTACCTCTCGCCAGGCGACGATCTCACTACCGCAGCCGCTGACCGCAGTCTCGCCG
CTGCCCTCGACGGTCGTCCGCTCTACGAGATCTACAACTGGCAGCATGTCCTAGCTCAGGCCAGCATCCAACCCCTGGAC
GCTGTCGCCGTCGCTGCCACGGGCGCTTGGCTGGACGGCCTGTTGGGCGTCGCTACAGGCGGTACAGCAGCTACAGCATA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62