GenePrediction:GLEAN_2076 Details

Name: GLEAN_2076
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:565703..567423 (+ strand)
Length: 1721
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:565703..565727 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_108:565835..566120 (+ strand)
Length: 286
Type: CDS
Source: GLEAN
Position: GCSC_108:566265..567081 (+ strand)
Length: 817
Type: CDS
Source: GLEAN
Position: GCSC_108:567337..567423 (+ strand)
Length: 87
>GLEAN_2076 class=GenePrediction position=GCSC_108:565703..567423 (+ strand)
ATGGCGATGCCAGAAGCCACGCCAGGTACGCTTGCCCCTTTCTTGGTCTTGGTCTTGGTCTTCCAAGGCTTCCTCGTCTT
CTCTCGATCATCTCTTGTCCTCTCGTCTCTTCCCTCCTTCCCCTCTTCACAGCTGACGAGATTCTTCCAGACCATGCCGA
TCGGCCTGGCAGACGACGACCGTTCACGACGTGGGTCAAGAAGCTCGCACACTTCAAGAACAACGGCTCGAGCGACGGGC
GAACGCCTGGGTCAAAGCGGCACCTGACACCGATCAAGATTGCGCCCAAGAAGCGAGGGCCGACGAGCAAGAAGAACAAC
CCGTATCCGCTGTCGGGCTACCGACCGGCCACGGATGGCGGCATCAGCAGCAGCACCCACCACAGCCTTCAGGGCAGCAG
CCAGATATCCTACACAACGTCGCTAGACCGCAGCCGGCGGAGCAGCTCGGTGCAGACGGGCAGCGACGACGGCGACGATG
AGCACGGCGACGAGCACGGTGACGATGACGACGACAACGACAACGACGACAACGACGACGCCCACAGCAGCGACGACGAC
AGCCGAGCACCGCCGACAGTCGGGGCGCTATCGATGGCGCCGACCGTGTCGACCGAGCGGCGATCGATGCTGGCGCCATC
CAACGGGGCGGCCTCCTCGGTGACGGGCACGACGATCCGGACGCTCAACGGCTACAGCTCGCGGCGCGGTGGCGACAGCA
CATTCTCGTCGCCAGCACCATCGCTGCAGTCGCTCGCCACGACGCTGACGACGATCCAGTCGCTGCAGGTGCCAGGGGGT
GCTGGTGGTGGTGCCCATCACGGCCACGGAGGCACGAGCCTGAACGGATTCGGCAGCAACGCCGGCAACGGGACCGTCAG
CAGCGTTGGGTTCGGGTCGCTACACACACACCACGCGACGCCGTCCGCACAGATGAGCGTGCTCTTCCACCAGCCGTTTC
CCAACACGCCGGCGTCAGCGATCCCGTCCCATCTCGCAGCGCCCGGCAGCGGCCATCCGACGACGTACTCGACGGCCACG
GCCAACAACCTGCTGACGGACAACGCATCGATCCTGACGCTGGCCTCGTCCAGCAAGCGGCGACGACGACGGTCGCTCGA
CACGGACGCGTCCGTGCGGGCGCTGGCGCCGTCGTCGCTCTTTGGCGGCAGCCGCGAGAGCCTGCCGCTGTCGGTGCTGT
CGGCCAACATTGACGGCGGCAACGGCGGCGGTGGCAGCAGCATGCCGACGGCAACCGGCATGGCACTGCACGGGTCGGGC
AGCCGCATGAGCGTGGCCGAGCGCACGAGCATCTACAGCACGACGGGCATCCTGGGCGATCGCAGCAGCTTCTACGCGCG
CGGCGGCAGCGCCGTGGCAGTGGTTGCGCAGAGCGGTGGCGGCAATGGCAGCGGTGGTGGCAGCGGTGGTGATGGGGCCA
GCGTGCGCAGTGGTCGCAGTGGTCGTAGCGGTCGCAGCGGCCGAAGCGGCGGCTACCTCGGCCATGGTCGTTCCGACAGC
GTCGGTGGCAGCCTGGCCAGTCCCCTGGCAAGCCCCTTGGCAAGCCCCTTGGCAAGCCCCTTGGCAAGCCCCTTGGCAAG
TCCCCTGGCAAGTCCCCTGGCCAGCCCCCTCGAGGCAGCCGAGCCGGTCGCTTTGGAGCTGGTGGTCAAGGCCGAATGGA
TCGTCGCAGACGAGCAGAAGGACAAGGACAGGACACAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62