GenePrediction:GLEAN_2079 Details

Name: GLEAN_2079
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:575451..580245 (+ strand)
Length: 4795
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:575451..575811 (+ strand)
Length: 361
Type: CDS
Source: GLEAN
Position: GCSC_108:575874..579735 (+ strand)
Length: 3862
Type: CDS
Source: GLEAN
Position: GCSC_108:579900..580245 (+ strand)
Length: 346
>GLEAN_2079 class=GenePrediction position=GCSC_108:575451..580245 (+ strand)
ATGTCGAGCTCTCTGAGTACTGGCATCGCCAAAGCTACCAACATCATGATTAAGCCGACGCACATGTACGACTCCATGGG
GAGAAGGAAAGAGGGTGTGGTGAAGGCTGTTGCCGCCGCCCGTTTCGAAGACGCTTTGCAAACATTCAACAGGCTGTGCT
CGAGGCTCCTGTCATTTTCCCACCTGATCACCGAGACCGAAGCAATCAAGCAGCTGGAAGATGTCTATGCCCGCTTTTCG
ACTTGGGGTCACGAGACTGGCGCCGAAGACCTATCATTGGACCGGAGGCTTCGCAAATCTAAAGAGCTACATGAAACTGT
CATTGATATATTGCATGAACTCCAATCGGCGCTGGATGATGGTGAGTCAGTGCAGAGTGCGGATTCTTTTGCTGGACAAC
GATGTTCTAACACTCAATATAAGGCATGCAGTTAGTGGAAGAACAGCAGTTTGCGGACTGGACGAAACAGCTTATCGAGC
AACAAGACTTTGACCCCCCTGCAATCATAGAAGAGATGGCACAAGATGAAGTCGACCCTAGGGACACTGGCCCCACCGGG
CCCCCTGTTGATGACGCGCAAGCAACTGTGCTTATGGAAAGACTCCTGGAAGCGGTCGACGAAATCAGCGGCAATGTCGA
CAACCTCATCATGCTCGGCCCCAGCCTTGAACGGCCCTACCCCCAAGATATTGACGCATACGCATCCAGTATCAGCAATA
CGAGCGATATCAGTGACAGCATGGACATTGAGAGGGCGTGCCTGGAGTTTCCTATTGCTTCAAGCATACTCCAGAAACGA
CTGGGCCGCGCAAACTGGAAAAGACGGATCGCACAGATGGTGGTCCACGAGCAGAACCGGAAAGACGGGAAGATCCATCC
CCCCAGACAACGGACCAAGAAGACAGTTCGACAGGAGGTAGCCCAGGATGCCTTCAACTTCCAGCAGCCTACGCTTAGAA
GGGAGAAGCTAGTGGTGGTACCGAAGTTTCTGCCTCTCATGTCGGTGACGGCCAGTACTGCAGAGGTGTCCGATACGGCG
TCAGACCTGTGGGACACGAATCCCAGGTCTAGCACATCCAAACTCAATCGTGCTAATTCGGCCACGACGTTGGCAACAAT
GGCAACATATGAGTCTAATAAGAAGGTCCAGACTGGAATGAAAATGCTACAGCTGGCGGCGGCCAAAGAGGCCATGTTTC
CAAAGACACCAGTGCAGCTCACGGAGATTCCAAAAGGCCGTACAGTGGCGTTCACATGCAACTTTTGCGGCTATGACCTT
GAGGCGGGCGGGAGAATTCAGACAGAGGAGGACTGGAACCAGCACCTACTAGAAGATTTGGAGCCGTACCTATGCACGTT
TGACAAGTGCTTCAGTGCGCAAGAAACATATGCGCGACGAGATGAGTGGTATCGTCACGAGCTAGAGTCGCACCGAGTTC
ACAAGGCATGGGTGTGTCCGGCATGCCGAGAAGAGTTCAAGACCAAGCAGGAGGCGACGGAGCACCTAATGCAGATCCAC
TGCTGTGACTTCAAAAACGAGAAGGAGGTGGTCATGATGAAAGCCATGTTGAAGCAGACGCTCTCCAGCCGGATTTTAGG
GACACAGATATGCCCTCTTTGCGGCGAAAAACTCGAGGCTCGCCGCTGCAAAGAGCATATAGCGCGACATCTGGAGTGCT
TTGCTCTACTCTCGATTGCCGAGGAGGCCACGTCTGATGAGGACGAGTCGGACGATATCTTTTCGCAGAGTGACGACGCG
ATGTCGGACCGCGGACGGAAGGAGCTGGTGCTGAGCACGTTTGTCAGGGAGCAGTTCAACCTCAATCTGGAGAGAGGTCA
GCAGCCACCGGATCGTTTTATGGACGGAGGCGGTGGGCTGGATCTGCTGGAAGACATGTCTGAGTGTGGCGATTCCAAGG
ACTCGGAGCCGCGCATAGGAAATGCGCGGCAGCGGGAGTCGACACAGATGTTGATGGACAAGATGTTCCACGGCTACGGT
GGCGCACATCCGACGATAGCAGCACGGAGAACGGCGACGACAACGGCAGAAACGTCCGGCAAGCGAGCAGCACGCTGGCC
ACAGCAACAGCAGCAGCAGCAGGTTGGAGGGCCCCCCTCGCTGGCATCATTGACAGAGAAGCTGCCCCTATTGCGGACAT
GGTCGTTTCCGCGAAACGCAGACTTTATGGGCCGCGACAGGGAGCTGGCAAACCTGTACAAGATCCTGTCGGAGCCGGGC
AAAGTGTGTGTGGTCAGCGGCGAAGGCGGGATGGGCAAGACAGCACTGGCAGTGGAGTACACATGGCGATACGAGCAGAG
CTACCACTACATTTTCTGGGTACAAGCTGAGACGCCGGTGGGGTCCAGTGACACGTTCTGCCAGATTGCACAGCAGATGC
GGCTAGTGCCCGAGGGCACGGACCAGGAAACGATGATCCGACTCGGACGGGAGTTTCTGGAAGGGATTCGGGATAAGCGG
TGGCTGATGGTGCTGGACAACGTGGAGAAGTGGGACGACATTGACGTGTACACGCCAACGAAGACGTCGGCGACGCAGGG
GTCGATCCTGATTACGACGCGACACGAGAGCCTGACGGCGCCGTCACGGCCGGTCAACTACTTCCGCACGACGCTGCAGG
AGCTGAGTATCGAGGAGGGCCGGCAGCTGCTGATCCACGGGCTGCCCGAAGACCTGCGGCCCAAGGAGATGTCCCTGCGC
GACCGGGAGTACAAGGTAGCGGGCGAAATTGCCGGGCTGGTGGGCCTGCCGCTGCTGATCGTGTACATCTCGGGCTACAT
CAAGAATTTGGGCTGCACGCTGTCGGAGTTCTGGGAATATTGGAACGAGTGGCGGCCAAATGCCCGTCTGTCGGGAAGCG
GAGGTGGCAGTGGCGATGCCGGTGGTGAAGCCGGGAAAGGATCCGGGGATGTCGAGGATGATGCCACAGAGGGGACGAGC
AAACGCGACACGAGCGGACGCGAAGGGGTTTTTTACATGGCGCTCCGGGACCTGAGCACGGACGAGAAGAAGCTACTGAA
GATCATGGCCTTTCTGGACAGCGACGGGATCCAACGAGAGCTGTTGGAGTGGAACGATGCTAGCCGTCCGGGGCCGGGGT
ATCTGAAGAAGAGTCGACTGCGGCTGATCATCAGCAAGCTCAAGGGCCAGAGCATCGTGACGGAGAAGCGGCAGGGCGAG
CGGGAGACGTACAACGTGCACCGGCTGTTGCAGGCGCGACTTCTGCAGGACATGAACGGCAACCAGGCGGAGCGGGACGA
GATCTTCATGCTCGCCTTCAGCCTGATTCGCAGCCGGCTGCCACGACCGTCTCTGGACACGCCAGAGCCACACAAGTGGA
ACGCGTTCAAGGAGTACCTGCCACATGTCCTGAGCCTGCAGCGGGCATACGCGAACCCGCTGTCGATCGTGACGGTGCGG
CCGTTCCGCGGCCTAGCCGAGCTGTTCAAGGACGGCGGCGTGCTGTTGTGGCAGCGGTATGTGCACGGGGACGCGCTGAA
GCTGCTGCACTCGGCCGAGAAGATCCTCGATCAGGTGCGGCAGTACAGCGACAAGAGCGACAAGAGCGACGGCGGCCATG
ATGAGGGCGACAGCGACGAGGACGAGAATCTGCGGGCCGAGGTCAACATTACGATCAACCTGCTGCTACAGTACTTTGGT
ATCAGCTTCCGCAAGGAGATCCGGGATCGGTCGGCCGCGATCTTGGCGTATCACGAGCGAGTGGCACGACGGCGAGGCCG
AGACAAAGGCGTCGACGACGGTGATCATGGCGGCTCCGACGACTACGAGGACCAGCTGATGGTCAGCAACGCGCGGGCCG
ACTACGCCAACACGCTGCTGCAGTTCAACGACTTCCGGCAGGCCGAGCCGATCTATGAGGCCTGTCTGGCGACGTTCAGC
GCGGCAGCCAGCACGAGCGCCAAGGACAACAGCGACAGCAACACGGCCTTTGCGCTGGCCAAGCTGCACCACCATCTGGC
GTACTGCCGCATGTACCGGCACCAGTTCGACGAGGCGGTCGAGCTAGCCGACCAGGCCGTCCGCATCATCGAGCGGGTCA
GCGACATGGCCATGGCGCTGCGGTATCGCTTCGACCTGGCCTGCATCACGCTGCAGTCAGGAAGACGAGAACAGGCCCTG
GCCCTGCATCAGGGCATCCTCAAGGCCCGGCTCGGCTTCCAGGGACGGGCCAGCTACTTTACGCTGCAGAGCCAGTACGC
CGTGGCGGCGCTGTGTCATTATCTGGGGCAGCTGGAAGAAGCCGAGTGAGTTTGATCCTTTGCTTTCGTCCTTTCTTGTT
CTTGTTCTTTTGTTCTTCTTCCTGTCTTGTTCTTCCTCTCTTCTTCTTCTTTTTCTTTTTTCTTCTTCTTCTTCTTCTTC
TCTTCTTCTTCTCTCCTTCTTCTCTCCTTCTCTCACACTAACATCCCAGGATGCTCATGAAATCGGCCCTGTCCAAAGCG
GCCGGTCGAGGCGGCAAGAACTTCTGGCCAGACGCAGCAGTGGCGCGCACCAAGTACCACCTCTCCTTGGTAATGGCAGA
GCGGGACAGCAGCCGGGGTCTGGTCGGGATGGATGAAGAACTTCGGACACGGCGGCAGGACGAGGCTCGTAAGCTGGCCT
TTGAGGCCAAGGACGTTTTGTCGCGGATGCTGCCTTACGACCCAGAGCCGATCACAGGTGTTAGGGAGGAGGACACGCTG
GCGCTGTTCGATCATCTGCAGCCGGTGTTTGGCGGTCGGTTCACGAGCACGAAGCTGTTGGGGTATATTTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62