GenePrediction:GLEAN_207 Details

Name: GLEAN_207
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:230573..232479 (+ strand)
Length: 1907
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:230573..231294 (+ strand)
Length: 722
Type: CDS
Source: GLEAN
Position: GCSC_167:231365..231937 (+ strand)
Length: 573
Type: CDS
Source: GLEAN
Position: GCSC_167:231999..232479 (+ strand)
Length: 481
>GLEAN_207 class=GenePrediction position=GCSC_167:230573..232479 (+ strand)
ATGACGAGTTTACGAGGCACCTTATTTGCGGCCATCCGGTCTCTGGTCCGGGGCAAGTCCTTTCTCAAGGTCCTGTTGCT
CAGACGGACAGAAGAGACGCCGGCGATCCAGGCTCCGGAGGACACAGCACCGACAGAAGTAGAATCGCCATCTGCATCAC
TTTCTCCATCTGCATCGACGCCGCTCTCAACGCCACTATCGTCATCCCCGTCTTCGACGCCGTCATCGGCTGCAACCACT
ATTCCAATCTCACAACAGATAAATACAACACGACCAGTAGCGGATTTCTTGAGTGAGGCTGAGGAACTACTGCTTCGCCC
AGTTGAAAGTGCCCGCTTGGGCCTCTTTTCCCGGCAGCTCAAGGACCAGTACCGTGAACGATTATTTGCAAGCCCAGCAT
GCATGCTTCCGTCGTATAACCACCAACTGCCCAATGGCCAAGAGTTTGGCCGCTACCTATGTCTGGATGTAGGTGGATCA
ACGCTCCGGGTGGCACTCATCGAACTTCATGGTCAGAATCGGAAAGAGCTAGAAGAGCCCGAGTCGAACATTCTTTGCAT
TCAGACGGTTAAAATCACCCCGGACGTCAAGAGGCTTGAGGGCATGCAGTTCTTCGACTGGGTGGCTTTCCATATCGCCG
AGACAGTGAGCAAAGTTGGAGGCGTCAAAAACGCTGCAGATGAGGCCTTGCCCATGGGCCTTGCCTGGAGCTTCCCTATT
GAGTGCGTCAAGACTGCCTAGCCTCTGTTCCTGGACCATTCACCAGCCTGTTCTGCCAGCTGACCGTTTTAGGCAAACTT
CCCTCCGCGGTGGCCTGCTCCAAGGTATGGGCAAAGGCTTCCATGCAGCCGACTCACTAGAGGGGCAGGACTTGGGTGAT
ATAATACAAACGGCTTGCACTTCATATGGGCTTTGTGTGGAGCTGGCTGCCATCGTGAACGACTCGGCAGCGGCACTTCT
TTCGGAGGCGTATGTGCGGACATCTACCCGTTTCAGCCTGATCCTTGGCACCGGTGTCAACATGGCTGTGCATCTTCCAG
TTTCCATGATAGGCCGGCCAAAGTTTGGGAGCCGCCCTGAGGCCTGGTTCGATTCGGCTAGTCATGTGATAGTCAACACG
GAGTTGAGCATGTTTGGCTGCGGCCTTCTGCCGACTATGCGCTGGGACATGTTGCTCAAGGCTGATCACTTGAGGCCCGA
CTTTCAGCCACTCGAACAGATGGTATCTGGATACTACCTGGGCGAGATTTGCAGGTTTGCACTGATCGAGGCAACTACCA
CAACTGGCCTTTTCAGAGGCATCCTTCCGCCGTCTTTGCTGAAGCCATATTCACTTGATACTGAGACTTTGTCGATTATC
GAAAGGTACATTGCATTTGGTGGTGGCGTGTACCATTTCAACGACGATTTTCTAATTTCCTAACAGCGATAGCTCTCCTT
CTCTGGAAGAAGCCACAGCCATCTTCCATAGCCGCCATCCTTGCATTGACGGTTCGGCACCGACGAAGGCTGATATTGCT
ACTGTGCGGGCGCTTGCTTCGCTGGTTTCACAGCGATCGGCCGCAATCGTTGCCGCGGCTGTATATGCAATGTGGTTGCT
CAAAATCGAAACGGAAGGCGAGCTTCAACACGGACTAGCAGATTCTAGTGAAGGGATGCTGGCACGACGGCATGCAGATG
CAGCCAAGGCGGAACTCTCCATCATGCACGAGCGCACTGCGGTGGCGTTCAACGGATCTGTGCTCGAACGATACCCGCGA
TACCTAGAGCAGTGCCAGGGTATTTTGAACGAGCTTCTTCTCGGTGATGCCAAAGCTGGTGAACCGGCGGGTGTGATTGA
GATGGTGCCGGCCAAGGAGAGTTCGTTGTTGGGTGCAGCAGTGTCTCTAGCTTGCCTAAAGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62