GenePrediction:GLEAN_2082 Details

Name: GLEAN_2082
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:596069..598764 (+ strand)
Length: 2696
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:596069..596115 (+ strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_108:596199..596234 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_108:596305..596345 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_108:596419..597230 (+ strand)
Length: 812
Type: CDS
Source: GLEAN
Position: GCSC_108:597283..598764 (+ strand)
Length: 1482
>GLEAN_2082 class=GenePrediction position=GCSC_108:596069..598764 (+ strand)
ATGGGTAAACGCAAGGTAGCCGCCCTGGAGAAGATAGATGCAGACTTGTGAGTGATGTGCCCTGGCAGCCCTGGCATTTC
CGGGAAGCGAGCCGCCGCCAGCCAGCCGTTCACAGCTAACGATATGCCAGATCGAATCTCCAATACAAGATCCGTCGCGA
TCCAAAGTGAGTCGTCACGACACGGACGAGAGCCGGATGCGGTCCGACGAGAAGGACGTTCTGACATTGTGTCTAGGTCA
TACGAGGATGAGTTTCAGAGACAGTACGAGCAATATGGTGCGTGAAGAGCATTCTGTGAAGTATCTTTCGGCGAGTATCA
AGTCCGCCCTCCCAGCTGACCGGCCGACAGTTTCGCAACGCGACCTATTCCTTACGTCGCCGGCCAACGCGTCGGCAGAC
CAGAGCCGGGCGTTCCATGACCTGATCGACCTGATCGCGCACGTGGCGGATTGCTATCCAGAGGCGCTGAGCGGCTTCCC
AGGTGAGCTGGCGGCGATTTTGACGCAGCACCACGCGGTGCTGCAGCCAGAGCTTCGCGACAAGATCGTCGGCAGCATGG
GGCTGCTGCGGCGCAAGGACGTGCTGGACTCGGCGACACTGGCGCAAACGCTGTTCCCGATTCTGGCCCACACGCCGAGC
AAGACGCTGCGCACGCTGCTCTTTCGTCGGCTCGTCTCAGACCTGCGCAACGCCAATAGCCGGACGAAGAACCACCGGCT
CAACCGGACGGTGCAGACGGTGCTCTACAACCTGGTGTCGTCGGACCGCACGACGGCGCGGCCGATCTGGGCTGTCAAGA
TCACGCGCGAGCTGTGGACTCGCCAGGTCTGGACGGATGAGAAGCCGGTGGACGTGATGCGCGAGGCCTGCCTCGGCGAC
AACGAAAAGGTGGTCGTGTCGGCCGTGCGCTTCTTCCTTGGCGGCGACAAGGCGCGCGAGGAGCTCGAGGACGACAGCAG
CGACGACGGCGGCCGCGAGAACCGTTACGGTGGCGCACTTGGTGGCGGCAGCGGTGCCGTCGACCTGACCAAGCTGAAGC
AGCGCGGCCAGCACAGCAAGAAGACCAAGAAGACAGCCAAGCGGTACGACCGGGCCGTCGAGAAGGTGAAGAAGACGGAG
CGGAAGCGGAACCAGCCGCATCCGCTCAACTTTTCAGCCCTGGTAAGTGGAAGAAGTAGAGACGAAAGAGGAACAAGAAT
GCTGACAAATCCAGCATCTGCTGCACTCGCCACAAGAGTTTGCCGAGGCGCTGTTTAACCGGCACCTACTGTCGGCACGA
TGCAAGTTTGGGCTAGAGAGCAAGCTGCAGATCCTGCAGCTAGTGACTCGGCTGCACGGGCTACACAAGCTGATCATTCT
ACCGCTGTTCAGCTGGTTCACAAAATACCTGACGCCGCGACAGACATCGGTGACGACTGTGCTGGCATCGCTGGCGCAGG
CGGTGCACGACCAGGTACCACCGGACGCGCTGGAGCCGCTACTAGCCAAGATTGCCAACGAGTTTGTGACGGAAGCATCA
GCGGCCGAGGTGGCCTCGGCCGGCCTGGCGGCGATCCGCGAAGTGGCGATGCGGCAGCCTCTGGCGATGAACGAGACGCT
ACTGCAGGACCTGGTGCAGCTGCGCAAGAGCAAGGACAAGAGCGTGATGATGGCGGCGCGCGGCCTGCTTTCGCTCTTCC
GCGTCGTCGGCGCCGAGATGTTGACCAAGAAGGATCGCGGCAAGGAGGCGACGATGGGACTGCGCAGCGGCGAGGTGCGG
CAGCGGCGGTTCGGCGAGGAGGCAGGCGGTGGCGGCATCGAGGGCATCGAGCTGCTGGAGCAGTGGAAAGCTGACGAGAG
GAAGCGGAAGCGAGCCGAGCGAGCCGAGCAGGCAGGCGAGGACGCAGACAAGGACAAGGACGAGGATGACGAGGACGATG
AGGACGACGAGGACGACGAGTACTCGGAGGGCAACTCGAGCGACTGGGACATGTCCTACAACAGCGACGACTCGGGCGGC
TGGATCGACGTGAGCAGCGACGAAGAGGGCGAGAAGGCACCGCCGATCAAGCGGCAGCGGAGACGGGCCAAAGAGGCGGC
TGAGGACAGCGATGACGAGGCCGAGGGCGACGATGAGAACGAGGACGGCGAGGACGGTCAGCCATCGATCTCGAAACTGG
CAACGACGACGATCCTGACGCCGGCGGATCTGGCAAAGCTGCGGGAGCTGCGCCTGGCGTCCAACATGGAAAAGGCGACA
GGCAGGGGCAGCAGCAAGAAGGTCGTCGGCGAGGCTGCAGACCCAGAGGCGGCGGCTGAGGCGGCCGAAGCGGCAGCTGC
GCGCAAGCGGGCGGCCACGATGAGCCGGTACCAGGCGGCCATGGCAGCGCGGCACACCGACGACGGGCTGACGGCCGCGC
AGATCGAGCTGGCGGCAACACTGCGCAAGTCGACCAAGGAGGAGAGGATTGCACGGGCCCAGGAAGGCAAACCGTCACGT
GACCAGCACCAGTCGACGCAGGCGATGCGCAAGGCCAAGAAGGCGGCCGAGGGCAAGTCGCTGACGAACAAGGAGAAGGC
GCGCAACAAGAACATCTTCATGCAGATGGGCAAGGCCCGGCAGAAGAACAAGCGCAGCCTGATGGAGACACGCAAGGCCC
TGACGGCGCACGTGGCACGGGCAAAGCGTGGTGGCCGTCGGGGCAACCGAGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62