GenePrediction:GLEAN_2083 Details

Name: GLEAN_2083
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:608298..609463 (+ strand)
Length: 1166
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:608298..608385 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_108:608450..608488 (+ strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_108:608553..609463 (+ strand)
Length: 911
>GLEAN_2083 class=GenePrediction position=GCSC_108:608298..609463 (+ strand)
ATGGACGAGATGAAGGCACGGACATTCACGGAAGAAGATACGATGGCCGAGATTCCAGTATGCACAAAGACGTACAAGCT
TAACAACGGTAAGCGGAGCCGAGAGAGACGAGTTGTGATCGCGTTGGTGATTAGTAAGCTGACAGCAGACAGGGGTTGAG
CTTCCGGCCGTCGGGCTGGGAACATGGCAAGGTGGGTATGCTGGAGGATGGGTGACAGGGTGATGTGATCAGGGTGCTCA
GCTGACCGGCCACAGGCACGTTTGGCAGCAGCGACGAGCAGGCCATGGTGGACTCGATCGTGCACGCGCTGCAAGCTGGT
TACCGGATGATCGACACGGCGCAGATCTATGGGGTAGAGCGAGTAGTAGGCCGGGCGATCGGCGAGAGCGGCGTGCCGCG
CGACCAGATCACGGTGGTGACCAAGTTCTGGGGTTACTGGCACCACGACCCGGCCGCGGCCCTGGCGATCTCGCTGCGTG
ACCTGGGGCTGGACTACGTCGATATCTTCCTGATGCACTGGCCGCAGGCGATGACGCCGCTGCCAGACGCCGCAGTGCTG
CCGCCGACGGCGAGCCCGACCATCACGCAGACGTGGCGCCGCATGGAGGCCCTCGTGGGTCCGCGCTGCCGTGCCATTGG
CGTGTCCAACTTTACGCAGCGCACGCTCGGACAGCTGCTCGACAGCCACGTCGCCGTCGTGCCGGCCGTCAACCAGGTCG
AGCTGCACGCGCTCTGTCCAAACCTGCGGCTGCTTCCCTACTGCCAGCAGCACGGCATCCAGGTCGTCAGCTGGAGCACG
CTCGGCGGACCGGCCAGGTCCGACGGCCCCGCGAACCCGATGCTCCAGCACGCCCTCTTCACCGACATCGCCGCCGCCCA
CAACATCAGCCCCGCCGCCGTGTCGCTCTCGTGGGCCGTCCAGCGCGGCGCCGCCGTCATCCCCAAGAGCGCTAGCACCC
GCCGCATCGACGCCAACATTCGCCTCGTCACCCTCTCCGACGCCGAGATGGCCACCATCAACAGCGCCCACGAGACACTC
GGGCTCATGCGCCTCTCCGACCGCTCGATCTCGCTCGGCGTCGTCGTCGATGGCAAGCGCACGCTCCTCGGCTGGACCAA
CGTTGAGATGGGCTGGCAGGACGAGGAGGGGAATTGGCTGACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62