GenePrediction:GLEAN_2086 Details

Name: GLEAN_2086
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:618529..620898 (+ strand)
Length: 2370
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:618529..619161 (+ strand)
Length: 633
Type: CDS
Source: GLEAN
Position: GCSC_108:619252..620088 (+ strand)
Length: 837
Type: CDS
Source: GLEAN
Position: GCSC_108:620206..620898 (+ strand)
Length: 693
>GLEAN_2086 class=GenePrediction position=GCSC_108:618529..620898 (+ strand)
ATGGCGATGCCGAGCACAGAAGCGGCCGTTGATGGGCAGGAGGAGGCCAAGTACGAAGGATCCGCACACGAAGATGCGTG
GACGCGCGACGAACGAAGCTATGAGGAGGACGAGCAGGGCCACGAAGTAGCGGAGGAGAGCTTTTGTGATGACGGCCCAC
GTGGCGATGTGCATGGGAGCAGCGATTCCGAGCGGGAGGAGCACAGCGGCCATGACCACGACCACAACGACGACCACAAC
GACGAGCACGACGAGCATGACGAGCATGATGACGATGTGTTCAGCCAGCACAGCCAGAGCGAGCGCAGTCCGCGCAGCTC
GCTCGACGGGTCTCTGGACAGCCACGGCGGCAGCTCGGGCAAGAAGACAGCCAAGGCGGACGAGAGCTACGAGCAGCACG
AGGACGGCTACGACGACAGCGTGCATCATCACCAACGGCTGCCGCGACTGTCGGGCATGTCGGCGGGGTCGGGCTTTTCG
CAGGGCGGCGCGATCTCCAACATGTCGCAGTACCTGGAGGACTCGACGGCGGACTCGGGCCACGACGGCGGACAGAGCCA
GTTTGTCGCGCGAGCGGTGTCGACGTCGATCGGTGGCAGCGGTGGTCGAGGGGCGTTTCGGACGCCATCGGCGGTGCGAG
CGATGCAGATGTCGTCGCCGTCGCCGTCGCCGTCGCAGTCGCCGTCGGTCATGTTTGGGATGTCGCCGCGATCGGCGCGA
CAGCGACGACGACAGCAGGAGCAGCAGCAGGGCCAAGGCGAGACATGGATCGCGTCGCCGCCGACACGGACGGCATCCCG
GTTCCGGCCGATCCAACCGGAGCCAGCGCCGCTGGTGTTGCTGCACGCGACGCTGATGCCGACGCGATGGGCCTGGGCCG
ACGTGCTGGATCGCTGGGGCGAGGCAGCCGAGGAGCAGGCGGGCGAGACCGAGCACGACGCGGCCGAAGGCGAGAACAGC
GAGGGCAGCCCGGGCAGCCCGGGGACACCCAGCCGGGCCTTCCGGCGGCTGCACACGGCCTGGTGCCGGCTGCAGTCGTT
TCTCAACGGCGAGACGGTGTCGGAGCGTGGCGTGCTGCTGCCACACCCGCAAAACGACTTTGAGGTGCTGGAAGAGCGGC
TGCTGGAGGCGCTGGAGCTGCCGGTGCGACGACGGGCGCGCATCCTTGAGTGCGGACACTACCTCGGGCCGGTGGACGAT
GACGACGACGACGGCGATGATGGGTACGAGGACGAGGACAGCGTGGCAGGCGAGGACGAGGACCTGGACGAGGACCACGA
CCACAGCGAGACGGACACGGCGCATGGTGGCGACAGCAGCATCAGCCGCCACAAGGAACGACGGCACTGGTGCGGGATGT
GTCGGGCGGAGATCCGCTACGAGCCACTGCGGGCGGAGCGGGTGTTCCGGGTCAAGGTGTACGCTAGCAACGGGCTGATG
ACGGCGGGCGCGTGGGCTGCGTGCTGGCGCGAGATGGAGCGGGTGGACGTGGAGATTGAGCCGGTGGTGACGGACGCGGC
GCTGCTGCGAGAGCTATCGCGAATCCGGGCAACACAGGAGGTGAGAGAGGTGAGAGAAGTGGGGGATGAAGAGAAGGAGA
AGGAGATGAAGGAGAAAGAGGTGAAGGAGGAAGGGCTGAAAGACGAGACAAGCGACATGCTTACGGAAAAAGTTCAGACG
AAGACGAATTCGGCTGGATGGAAGCAGCAGCACGAGTCGGCTTCACTGACCGCTCTCCTGATGGCAGCTGGTCGTGTCAT
TCTGCGCGATCACAAGCGCATGGCCATCACGGTTCTGAGCGGTCTGGTGATCATGCTGGTGGCGCTGCGAACGGCCACGG
CGCCACTAGAGGTGATCGTGTCGGCGGGGATGCCGGGTGTGGTCCCGCCGGTGGTGCCGGTGGTGAGCGCAGAGGCGGCC
GTGAAGGCAGAGCCGCTGATGCGCGAGCTGGCCGTCGCTGCAGGCAGACAGCCGGTGACGGACACGATCGCGGGCATGGA
TGCCGTCCCGACGACGACGACGGTGGAGACGGTGACGCAGCGACAGACGGTGCAGGTGTTTGAGACGGTGACGGAGCGAG
TCACGGCGACCGAGAGGGTCCGAACGACGGAGACGGTCACGGCGACGGAGTCGGCCAACAAGGCCAAAAAGGTCTTTGAA
ATCGAAGCGGCGCGGACTGTGGCGCAGATGGACGTCGACAGCGTGGCGGCCGAGTACGGGCTCGAGCTCGTCGCCGACAA
GAAGAGCACGGCCGGCCAGCCAGGCTTCAGCCCCGTCGACGCCAAGCCAGAGTACATCGTGGCCGGCAGTCTTGGCGGGA
GCTGCTGCGATCGGAGCAGCTGCTGCGACCGAGATGTGGCCCTGTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62