GenePrediction:GLEAN_2087 Details

Name: GLEAN_2087
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:625787..627178 (+ strand)
Length: 1392
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:625787..627178 (+ strand)
Length: 1392
>GLEAN_2087 class=GenePrediction position=GCSC_108:625787..627178 (+ strand)
ATGCAGCGCCAGACTCTGCGGCCCATCGTGCAGCGGTTCCTTGGATCGTCGCCCTTCGTCTCGATCTCGATCTCGACCTC
GACCTCCGCTCTGCGTCTCTTCTCCTCCGGCCGCAGCAGGATGAGTGCCAAACTCAAGCCGGCGTCGCGGTTCTCCGACA
GCCGCAAGGATGTGTGGTCGATCATCAACGAGGCGGCAGCAGCGTCGCCGAAGCAGCCGATCGTGAACCTGGGGCAGGGC
TTCTTCGGGTACAACCCGCCGGCGTTTTTGCTGGCAGCGGCCAAGGCGTCGCTGGACCGGGTCGACTGCAACCAGTACAG
CCCGACCAAGGGACGGCCACGGCTGCGCAAGGCGATCGCGGCGGCGTACTCGCCGTTCTGGGGCCGGACGCTCGACCCGG
AGACGGAGGTGACGGTGACATCGGGAGCCAACGAGGGCATGCTGAGCGTCTTCACGGCCTTTGTCGAGGCGGGCGACGAG
GTGATCGTGTTCGAGCCCTTCTTCGACCAGTACATCAGCAACATCGAGATGCCCGGCGGCAAGGTCGTGTACGTGCCGCT
GCATCCGCCGGCCGACGGCAGCGAACAGACGACAGCAGCGTCGGCCTGGTCCATTGACTTTGGCGAGCTCGAACGTGCCA
TCACGCCGCGCACCAAGATGCTCGTGCTCAACACGCCGCACAATCCGGTCGGCAAGGTCTTCTCGCGCGCCGAGCTCGAG
CAGATCGCCGCCCTCTGTGTCCGCCACCAGATCATCATCCTGTCCGACGAGGTCTATGACCGCCTCTTTTACGTGCCCTT
TACCCGCATCGCCACCCTCGCGCCCGAGGTCGAGCGCATCACCATCACCGTCGGCTCGGCCGGCAAGAACTTTTACGCCA
CCGGCTGGCGCATCGGCTGGCTCATCGGTCCGCCCGACTTGATCCAGTACGTCTCGGCTGCCCACACCCGCATCAACTTC
TCGTCCGTCTCGCCGCTGCAGGAGGCCTGTGCCATTGGCTTCGAACAGGCCGAGGCCGAGGGCTTCTGGCAGACATCCAT
CACCGACATGAAGGCCAAGATGGACCGCTTCAACGAGATCTGGAAGGAGCTCGGCATCCCCTACTCCGAGCCCGATGGCG
GCTACTTTGTGCTCGTCAACCTCAGCAAGGTCCACTTGCCGCCCGACTATCCTTTCCCGCCCGATGTGGCCAGCCGGCCG
CGCGACTTCAAGCTCGCCTGGTTCCTGATCCAGGAGCTGGGCGTTGCCGCCATCCCGCCCACCGAGTTTTACACCGCCGC
CAACCAGACCATTGCCGAGGACTACCTCCGCTTTGCCGTCTGCAAAGACGACGACGTGCTGGAGAGCGCCAAGGAGCGGT
TGCGCGGCCTGAAGAAGTACTTACGGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62