GenePrediction:GLEAN_2090 Details

Name: GLEAN_2090
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:647791..649796 (+ strand)
Length: 2006
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:647791..648551 (+ strand)
Length: 761
Type: CDS
Source: GLEAN
Position: GCSC_108:648608..649796 (+ strand)
Length: 1189
>GLEAN_2090 class=GenePrediction position=GCSC_108:647791..649796 (+ strand)
ATGGACGAGTCGACCGAAAGCAGTTGGCCGGAGCAGCCGCTACGAGCATCGGCAGCGCCACCAAGCCTACCGCGGCCACA
AAGCACAGTCCCTGTCCGATCGGGACTAGCGATGCCCACCGACACGAAAGACCGCAAGTCGTTTCTGACAGGCCTCGTGG
CGGGCCTGAGTCTCAACGAGATATGGATGCTGCAGGCGCAGCTGGCCAGGCTCGATCTGCGCACCGATGTGTTTGGGCGG
CTGCCGCCGGAGCTGCAGATCCTAGTAGCCGACCAGCTGGGGCCGGCCGATCTGGGCTGCTGCCTTGACGTGTCGCCAGC
CTGGCGCCAGGCGTTTCTGCACGAGTCTGTGCGGCGGGGCCAGGCGCGGCGCTGCTTCCCGGGCCTGCTGGAGTACGCGA
GCGCGGTGGAGCAGGCAGATGCCAGTGCCGAGCAGGTCGACCGCGCGTTTGCCGACACGGCACGCAAGTATGCTGCACGT
GCACGTGGCCGGTTCCGCGCTGCACTGCGACATGTGCCCCAGCCGAAGGCAGCGGTGCTGGCCGATATGGACGACGCGAC
ATTTGACGGGCCCGAGTATGCGTACGGCCGGCTCTTCTGGCAGCTGTACCACGACAGCACGACACACATCCGCGTGGACG
ACCTGCGCAGCGGGCGGCGGCAGCACTTTGCGGTCAAGGACGATATCGTGCGGGGTGAGCGGTTCATGCAGAGCTCGTTT
GGCGACGAGCTGGTGGCGATAGCCTTTAGCGGCACCCGTCTGTAAGTGTTCTTGTCACGGGCGGAGGAGTGATGTGGTCC
AGGCTGACGCTGTCCAGACTGGCGTGGAACTTTCGCACGGGCGAGCAGCACAGCAAACAGATGCCGGCGCAGATCGATGT
CACGGCGACGGTGGGCCGACGGGTGTGCGTGCTGTCACAGGGCAACATCTACGAGTGGGAGGTGGGTGGCAAGATGCGCG
AGGTGGACCTGACGGGCCTAGATGGACGGCACCGGCTGCCGGATCTGGACGGCCGGCTGCCGAGCTTCTTTTTGTTGGAT
CCGGTGCGGCCGGACGTCTTCTTCCGGGGCAACTTTGTGGTGGAGATGGCCGAGAACGGTGGAGGTGGAGGTCCGGCCAT
GGCGACTGGCACTGCTGGCACCGGCACGCTGTGCTTCTACGTGCACGAGTTCCGGGGACGGCGGTTTGCGCAGACGTTTG
CGTACCGGCTGCCGTTTGTCGGCTATGCCTTTCCGAGCTCGCTGATCGATACGACGGTGCGGCGGGACACGCGCGGGTCG
TTCTCGCTGGCGTCCTGGCGGGTGAGCGGGTCGTTGTCGGGCAGCGAGGCAGAGGGTGCACAGCCGGCTTGGACGGCGGC
CAGCGTCCGCGGTGTCGGCTCGCTGTCGTTCAACGTGTACACGCGCACGTTTGCGCTGTCGTTCTTCCGGCTGCCACCGC
TGGCACCATCGCTGGGCCGCGACCGACCAACGGCACTGCGTGTGCATCTCTGGGACGACCAGCTGCTGACGCTGATCGAT
CGCCACCGCGAGGCCCACGGCGGCGGCAAGATGCGCAAGGCCGATCCCATGCTCTTCGCCTTTGACGACGCCTACAGCGA
GGCGGCTGCGTGCTCACCGCCACCACCCTTTTCGGCCGTGCCGGTCTATGCAGCCGAGGACCACACAGGACACTCAGGAC
AGCCCCGGCTGGAATCACGCCGTCTGACGCACTTTGAGCCGGAGCCGTCTCGTTCCGGCAGCTGGTGCGTCGACGACGCC
GACTGGGCCAAGAACGGCTGTCTCCTGCGCTACATCCTCGACCTGGACACGCAGCCGGTGACGCCGGACAAGCCGGCCCA
CATTGGCGACTACCACATCATGGGCGACGATGACTTTGTCGTGGCCGTCCACCACGGCGAGCACACCGTCTGGATCTTTT
GTGCGGACGCTCCAGGCGAACGGAAGACCGGCGATCATGACGACAGCAACGACGACAACAGCCACAGTGTTCGTCCCGGA
GACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62