GenePrediction:GLEAN_2091 Details

Name: GLEAN_2091
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:650565..651649 (+ strand)
Length: 1085
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:650565..650692 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_108:650785..651536 (+ strand)
Length: 752
Type: CDS
Source: GLEAN
Position: GCSC_108:651597..651649 (+ strand)
Length: 53
>GLEAN_2091 class=GenePrediction position=GCSC_108:650565..651649 (+ strand)
ATGGCTGCTGTTGACGTCAAGGAGGCCGTGGCCTCCAAGCCGGAGGGCTTCAACCTGTACTCCCGCTTCGCCCTGGCCGG
CGCTGTGTGCTGCTCGGTCACGCACGGCTCGCTGACGCCCGTCGACGTGTGAGTTTTGGCATTGGCGTGTTTCCGGCTTC
CGTGCTTCCGTGCTTCCGTGCTTCCGGGCTTCCACGCTCTCTCGCTAACTGTCCGGCCAGCGTCAAGACCCGCATCCAGC
TCGAGCCGGAGGTCTACAACAAGGGCATGATCGGCAGCTTCCGCCAGGTGGTGCAGAACGAGGGTGCCGGCGCCCTGCTG
ACGGGCATGGGCCCGACGTTTGCCGGGTATTTCCTGCAGGGCGCCTTCAAGTTTGGCGGCTACGAGTTCTTCAAGCAGCA
GAGCATCAACCTGGTCGGCCTCGAGAATGCGTCCAACTACCGGACGACCGTCTACCTGGCCTCGTCCGCGGCCGGTGAGT
TCTTTGCCGACATTGCGCTCTGCCCGCTCGAGGCCACGCGCATCCGGCTCGTGGCCGACCCGACGTACGCCAACGGCCTC
GTCGGCGGCTTCAGCAAGATCCTCAAGACCGAGGGCGCCGGCGCCTTCTACGCCGGCTTCGGCCCCATCCTGTTCAAGCA
GATCCCCTACACCATGGCCAAGTTCGTCGTGTACGAGAAGGTCGCCGAGGCCGTCTTCCGTCAGTGGCCCAAGAAGGACA
TGAGCGACTCCATGCAGACCGTCGCCAACCTCGGCTCCGGTCTCATCGCCGGTTTCGCTGCCGCTCTCGTCTCCCAGCCG
GCCGATACCATGCTGTCCAAGATCAACAAGACCAAGGGCGCCCCCGGTGAGGGCACCACCACCCGCCTGATCAAGATCGC
CAAGGAGCTCGGCCTGCGCGGCTCCTACACCGGCATCGGCACCCGTCTGTTCATGGTCGGCACCCTGACTTCGCTGCAGT
TTGCCATCTACGGTATGTCTGGTCTCGTCTTGTCTTGAGCCTGTGGCTTTTCATGCTGACTAATCCTATCAGGTGACCTC
AAGAAGGCCCTCGGTGCCACCGGCGGTGTCGAGATCTCGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62