GenePrediction:GLEAN_2092 Details

Name: GLEAN_2092
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:659633..661612 (+ strand)
Length: 1980
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:659633..659810 (+ strand)
Length: 178
Type: CDS
Source: GLEAN
Position: GCSC_108:659868..661367 (+ strand)
Length: 1500
Type: CDS
Source: GLEAN
Position: GCSC_108:661509..661612 (+ strand)
Length: 104
>GLEAN_2092 class=GenePrediction position=GCSC_108:659633..661612 (+ strand)
ATGCCCCACGCGGTGCCAAAGGGCATGGGGCTGCAGGCCCTGATTCTGTGTGGTCCTGGATCCTCGTTCCCAACATTCAC
AGCCAGTCCGGATGAGAACCCAAAAGCGCTGCTGCCCATTGCCAACCGGCCGATGGTGTGGTACCCGCTTGACTTCTGCT
ACCGGGCCGGCATCACAGGTGAGTTTGCGCCGGGCGAGGCTGGCTCTGTCGATGCTGCATGCTGACTGGGGGCAGACGTG
ACGCTCATCTGCCCGCCCTCGGCGGCCGAGGCGATCAAGACGGCCCTGAAGACGAACCCGTTTCTGACCAGTCTGTCTGC
GCCGACGGTGGTGGCGCCGACGGAGCTGTACCACACTACGGGCACGGCTGCCATCCTGCGGCTGCCCGAGGTGCGCGCCG
TCGTGACGGCCGACTTTGTGGTGCTGCCGTGCGACCTGGTCTGCGAGCTGGGCGGCGAGAAGCTGCTGCAGGCATGGATG
GTGCGGGCAGCCTCGCTGGTCGACATCCTAGGGTCGGACGAGCCGGAGAGCAGCTTCCTGTCGGTGGCCTCGGCCGCTGC
AGCCTCGTCGACAGCCGCTGCAGCCGGCAGTGGCAGCGCTCTCCACAGCGGCGGCCTGGGCGTGTGGTACGACACCCGGA
CGGGCATCCCCAACGTCAAGAGCGAGGAGAAGGACTTTGTGGCCACGGTGCCGCTTGCCGGCTCGACCACGGCGGCGCCG
GTGCCGGCGAAGAGCACGGCGTCGCTGCTGCCACGCCTCGAGCGCGTGGTCACGGCCATGCCCACAGACTCGCTCAACGA
CCTGATGGAGGAAAAGGGCGACTACCCGGTGCGTCACGGCCTGCTGCGGCGACACCGGCGCGTGCGCATGCGCACAACCC
ATCGCGACGCCCACATCTACGTCTTCCCGCAGTGGGTCATGGACTTTGTGCAGGCCAACGAGCACATGGACAGCATCGGC
GAGGATGTGCTCGGCTGGTGGGCCCGGGCCCAGTGGCAGCCGACACTGCCCAAGAAGCTGCGCCTGCACAAGGTGCTGCA
GACCTACGGCGACCAGCTACACGACGCAGGCGGCTCCTCGCCACCGGCCACAGACTCGGGCGATGTGCCGCCGTCGGTGG
ACGGAACAGCCGCGGCAGACCTGTCGGCAGCGGCAGACGCGGTGGCAGCTGCAGAAGACATCACGTTGGCAGCAGCAGCC
GCAGCCACAGCGGCCGCGGCTGCAGGCGCTGCTGCAGAAACAACTGCAGCTGAACAGCAGGTGCCGCCATTCCTGGCCTA
CGTGCACCCGTCGGCGGCCACGGCACCGCTGATCCGGCGCGTGGACACCTCGCAGCTCTTGCTGACGGTGTCTCTGCAGC
TGGCTAAGCTGCCGTCGGTCGAGGAGGTGGCTGCCGGCACGGTCGACAGCAGCACGGCGTCGCCCTTTGCACACACGAAG
AAGGTGGCCTACCCAGAGGGCGTCAAGTCGCGGACGACCATCACACGGCAGGACAGCCTGGTGGCCGATAACGTCACGGT
GGAGGAGAAGGTCTCGATCAAGGAGTGCGTCGTTGGGGCCAACTGTCAGATCCATGAGGGCGCTAAGCTGCACCAGTGTC
TGCTTATGGAGGGCGTCGTCGTCGGCAAGGGCTGCCGGCTCACACGCTGCATTCTCGGCAAGCGAAGTGACATCGGGGCC
GGCTCGGTGCTGACAGACTGCGAGGTGCAGGAGAATCTGCTGGTCGAGCCAAAGAGTGAGTTCCCCCCTCCTTTTCCCCG
TTCCCCCTCTCCCATCAGGTTTGAAATATGTGGATATTGGCGTGTGTGTTTGTGTTTGTGGCGCACACTCGCTTCACGGT
CAACGGCTCGTGCTAACTGCAAATGTGATCCTTCAGCCGAGGAGAAGGAGAACAACTTTATGAGCTCCAAGGGCCTGGAA
GCGACGGCCGAGGAGATGGACGAGGCGCTGGAAGATGACGAAAACGCGATTGCTGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62