GenePrediction:GLEAN_2098 Details

Name: GLEAN_2098
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:701139..702293 (+ strand)
Length: 1155
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:701139..701336 (+ strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_108:701397..702293 (+ strand)
Length: 897
>GLEAN_2098 class=GenePrediction position=GCSC_108:701139..702293 (+ strand)
ATGTGTCGCTCGCCCCTCCACCCGCTTCTGCAGGCGCTGCCCAAATGCGAGCACCACATGCACGTCGAGGGTTCGCTCTC
GCCCGAGCTGCTCTTCACGCTGGCCAAGCGCAACAACGTGACGCTGCCCGAGGATCCGGCCTTTGCGTCGGTCGAGGCGC
TGTATGCCCGCTACGACCAGTTCTCCTGTTTGGACGATGTGAGTTTGTAGTCGATTGTCTCTTGCCTCTTGCCTCTGGCT
CTCTCGCTCACAGCCCAGTTCCTGCACTACTACTACATCGGCATGAGCGTGCTCGTCACGGCTGCCGACTTTGAGACGCT
CGCGCTGGCTTACTTTGAGCGGGCACACTCGACGCGCGTGCGCCACGCCGAGATCTTCTTCGACCCGCAGGCCCATCTGG
AGCGCGGCGTGGCCCTGTCCGAGGTCGTGGCCGGCTTGGACGCTGCCAGCCGGGTGGCTGAATCGCGCTGGGGCCTCACC
AGCCTGCTGATTCCCTGTCTGCTGCGTCATCTTCCGGTCGAGGACAGCGGTCGGGTGGCCGAGTCGTTGCGGCCGTATTG
GCCCTCGACCGCAGCACCGGCCGACAGCACGCCGCTCGCTGGTCTCGGCCTCTGCTCGTCGGAACGGGACCGTCCCCCGA
CTCTCTGGTCCGACATCTACGCCGACACGCGCAAGGCCGGTCTCGCTACCCGCTTCACAGCCCATGCCGGCGAGGAGGGT
CCGGCCGAATACGTCTCCCTCGCGCTCGACCATCTCGCCGTCGAGCGCATTGACCACGGCAATGCTGCTGCCCAAGACCC
CGAGCTCATGGCCCGTCTTGCTCGCGATCGCGTCATGCTCACCGTCTGCCCCCTCTCCAACGTCCGGCTGCGCGTCGCTC
CTAGTGTCGCCCATGTGCCTATTCGCACCTTTCTCGATGCCGGCGTTGCCTTCTCTGTCAACTCCGACGATCCCGCCTAT
TTTGGCGGCTACATCCAGGAGAACTACTGCGCCGTCCAGGATGCCCACATCCTCGAGCCCAAGCACTGGGAGATTATTGT
GCGCAATGCCGTCACCGGCAGCTGGTGCGATGACGATCGCAAGGCTGTCCTGCTCGCCGAGATCGACTCCGTCTTTGGCC
ACTGGCACAACGGCACTCTGGCCGTCGAGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62