GenePrediction:GLEAN_209 Details

Name: GLEAN_209
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:253544..254758 (+ strand)
Length: 1215
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:253544..253566 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_167:253642..253982 (+ strand)
Length: 341
Type: CDS
Source: GLEAN
Position: GCSC_167:254046..254157 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_167:254227..254758 (+ strand)
Length: 532
>GLEAN_209 class=GenePrediction position=GCSC_167:253544..254758 (+ strand)
ATGTCTAATCTATTTTCCGGAATGTCAGTTCTGCCGAAATCATACTCTACCCAATCCCCCCCCAATTTCCTTATATGCTG
ACCGTCCCTTCACGACAGCAACGCCCGTCTTCGAGGATCAAAGACAGGCGGCTCCAAGTCTCCTACGAACTCGAGCACAC
CTACAACTGATGCTCAATCGCCATCGTCGGCCACTGTTCAGAAGCGGCCATCCTTCGAGATTACAGCAGCCCCCGCCACA
GCTCCGTCTTTGCCCCCCCTCTCATCTGCCATCTCGACAAGCATGTCGACTGCCGGCGACAAGAGTCCGGACTCGGATTC
CATAGCATTACCGCTATGGCTCAATCCGTTGTATACGAAGCACATCGTGAAGGGCAACTTCATGACTCTCAGCGCCAGAC
CAAAGTCGGTAGAGCAAGGAGAATGGATCGCTCACCATGGTACAACCCCACTTCTCCCCCCTTTTTCTTGGTTCAGGGGG
TAACCTTCTCTGACACGACCAGTTGTTGAGCACTACCGGATCCTCTGGATTTTTGTTCGCCTAGTTTATGAGAAGGAGAA
GGATGGCAACACCATCTGCAACTCCACTAGTTGCCCCAAGATGTCGGCTGGAAAGTAGGCCATCTCCATCTCCAGCCGCT
GCCCCAGCCCCTGCCTGCTCTCGACTCCACGCTGACAGTGCAGAAACCATTCGTACACCTGGCTAAACAGCCGGCTCGAG
CCAATTGAGCTTCCAGCCCGTGAATACATGACTCTCATGCAGCGGTGGATCTCTGGCAAGATCGACGATCCCAAGATTTT
CACGACTGACCCGGCCACGACATCTTTTGCGGACAACCCGACCCTCGCTCCGAGCACGCCTCACCCATTTCAAAACAGCG
ATGGCGAAGACTGGGTTGGCAAGAAGAGCGGGTTCCCGAAAGAATTTATCAACGTCAGCCGGGCCATCTTCCTGCAGATG
TTCCGTGTCTATTCACATCTGTACTGGGACCATTTCGTCGACCCATTCTACCACCTCGAACTCGAAAAGCACCTTAACAG
CTGCTTCTCACATTTCATGTTGACAGCTACGAGCCTGAACATGCTCAGACCCGAGGATGTCGAGCCAATGCAAAACCTCA
TTGATCTGTGGGCCGCAAATGGCACGTTTCCTCCCGAGTCAAAAGCTTATGGCTTGGCGAATGTTGAGAATGGGAAGCGC
TTCATGCAACAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62