GenePrediction:GLEAN_2101 Details

Name: GLEAN_2101
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:718166..724956 (+ strand)
Length: 6791
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:718166..724073 (+ strand)
Length: 5908
Type: CDS
Source: GLEAN
Position: GCSC_108:724127..724956 (+ strand)
Length: 830
>GLEAN_2101 class=GenePrediction position=GCSC_108:718166..724956 (+ strand)
ATGCCCTGGCAACCGCTCCCTCACATCGCTTTCGCTGTTGCGACCTACCCCTTTGCTGCTTCGTACCCCGAAGATCTTGT
GCTCGAAATTGGCGACGAACTCTACATCATCGAAGAAACACCCGATGGCAATTGGCTTCGTGGCTACCTGCTCAAGCCGC
CAAGCTTGCTGGCCGGTCTGACCTCTGTCAAGGGTCAGACCCTTGAGGCTCGTGTTTTCAGTGGCATCTTCCCCCGCAGT
TGTGTCGAGGTGCGCGAGCTTCTCGGTGAATCTGACGACAGCGACGACGCGGACGAAGATGGAGATGCGGCCAACACTAG
CGAGGACGGCGTCGTCTTCCCTTCTGCACATGCCGCTGCTCAGCGTGGCAGCGACTCGGCTAAGAGCGGTGTCGTTGGCG
GCCAGCGGCGAAAGAAGAAGACTGGAAAAGACATCGTGCTTTCCATGGCCAATGGTGGCGGAGATGGAAACAAAAGCAGA
CCGTCCTCCTCCCGATCCCGACCAGCCACGGCCTTGAGCGCACAAGGCCACCTGTCTGTGCCCGTTGTGCGCGATCCCAA
CGCGCCAAAGCCTCAAGCCCCGGTCCCGATGCTGAAAATTGGAGACGAAACCCCGACTTCGGCTGCTGAACCTCTGATCG
ACGAGATTGCTTCATGTCTGCGCGAATGGCACTCGACGAACCTGCACGAGCTTCTCCTGTCTCGGCAATACCATAAACTC
GACATCCTCTCCCAATTGATTACCTCGCTGAACCAAGCACGCCAGCAGTTCCTCCATAACGTATTGACAAGCTGGGAATA
TACAAAATTGCGAGAGAAAACAGTATGGGATCTTGTCCGTGTCAACAAGCTCTGTGGTGGCGAGGTGATTGTTCGGGACC
CAAACGAACGTGGGCGCATTCTCACGGGTGATGATTCTGTTGTGGAAATCACACAGCTGCAATCGGTTATGAGCCTTCTG
AACGAGCCACCACCACCTTCTGTTGAGCCAACCGCCTTGCATCATTTACTGGTTGATGTCAAGGGCTTCGCTGGCGCCTG
TACGGAAGGGACCTCTCTTGTGCTGAGCCTAGTTGGGCGTGTGGGTGGCGAGCTTATTCGCTTATCCGAAAGCTTCACCA
CTGCGGTACCTTCTGGGATGATGGGACACCTGTTCAACCGTGCCTCAATGCGCACGCTCTTTTCCGACCTTTCCTCTTCC
GATATTGGCGAGGCCCCCGCCGTCGATTCTGACTTGTTTCTTGTTGTTGTTGTTCGCTCAGTTCGGCAGATTGCAGTGGC
TGGCCAACCTCAAGCAAAGCCGAACTCACGTTCTGGCGTCGGATCTGCTGGCTATGGTGGAGCGTCCGGCAGTGTCTCGG
GAAGCAAGGAAACATCGCGGCCGCCTCTTTCTAGCGGAAACAAATCTGCACGGAGAAGCCTGATGTGGGGAGGTAAGGGC
AGTCGCTCAGGTCACTCACGTGGAAGCAACAAGCTGGACTCTTTGAGCGAGACGTCCGAGGATCGTTCAATATCAGGCAG
TGCACCGACTAGCCGAGAGGGCTACTCGGCACCACCTGGCTCGGCAGGTTCGAGAGGCGGCGGCGGCGGGGGCGGCCGTT
CGCCGTTTGACTCTGCATTGCGTGTGACAGCTGATCGGATGACAGGCATCGGCGTCTTAAAACTGAATGCGATCATGAAG
CGACAAGATGATGACGTGGAGCATGTGATCAACATCTGGGCACCGTCGGAACGCGCTGGTGCATCTGCTGATAAGCAGCA
GACCGAGGATTGGGATCCATTTATCAAGGACTTGATGTTGAGCAAATCTGGCCAGTTTGAAAAGTCTAAGAGCTCTGAGC
GCGTCCAGGTGCATCTACGCGCCTTCAATCACCCAGACGCAGACACTCTGATCAAGTCTACACCGACCTTGCTCTCTGGC
ATCGTCAAGACATGCAAGATGGGATTTTCCGGAGCACCGACAAAACCACGTTCTGATATATACCTGACCATCAATGATGC
TGTACTGAGCCGGCAGGTACTGCTCTCCCGGTATGGCGCCAGCCCTGGTCCGTTTCCGAGCACCCTCCAAGGCAACAACC
TGCAAGTGACCGTCGAGGTACGGCGATCGAGTGGTGACCGTATCGACGGGTGCATCTTCCCGTATTCAAATACTGAGGGG
CTAAGCACTTGGCGATCGACGACAGTGGAACGCGAAGATGGATGGCGCCAAACTCTTCGCCTGTCTCTATCTCCCCCCGA
CGTTTCTACGTCTCACGTCGTCATGTTTGTTGCTGACATGCCAAATCCGCCATTTGCTGTTGCCTACATGCCACTATGGG
ACCAGTCTGCCTTTGTCCGGGACGGCTCGCACGGCTTGGTCCTGTACCGTATCGATGAATATACGGTAACGCCACAACCA
CCACCAGGGGGGGCTCCCGGCCGTGTTGGAGGCTACCTGTCACTACCTTGGAGTACGAAAGGTCGGGTTGAAAACCAAAC
AGTGGTTACGGGTGTACTGGCCAACTTGCGCGTTGACTCGTATCTCTGCAGCACACGCTTCTCCCAAGATCGTGTCGTGC
TGGGACTTCTCAAATGGCGCGAAGGACAGAAGGAAGCTGTGAGCGGGTTGCTGCAGCAGCTCATCTTTGTTCCCGAGATT
GAGGTTGTGAAGCTTCTGAGCGAAGTGCTTGATGCGCTATTCGCCGTCCTTGTGGAATACTCTGGCAACGACCAGTACGA
AGATCTTGTGTTCACAGCTCTTGTGCGAGTGCTCGATATCGTCCACGACCGGCGTTTCAACGTAGGTCCTCTTGTGGACC
ACTATGCCGAGACCAAATTCAACTCTCCCTTCGCTACGCCTTGTCTGGTGCGATCATTTACCCGCCTGCTCTCGAAGCCG
ACAGAACCCGAAATTGCGCGCAAGCTCCGGGCCACGTTCAAGGTTGTTCGCCATATCCTCAAGTTTATCACGCACGCCCG
CGGTCAACAGCGCGTTAAGGAAGCGGGCATTGGCATAACCTCTACTACACCGAACTTCACACGCCACATCCAGAGCATAT
TCAAGGCCCTTGAGGCAATGATGCGTAACACAGCACCTGTGCTTGTCGGAAGTCAAACACTCGCCGTCCAACACTTCCAT
ACGTGGCTACCCGAACTTTCTGGCCTGCTTTCTACGGAGGAAATACTACACATCGCCATTGATTTTATGGATGCTTGTGC
TGACGTCAAGGGCAAGCTTGTACTGTATAAGCTTGTGCTTATCATTAATTACTCCAAGCTGGATATTTTCTCGCACCCAG
AGCAAAGAGCCGCCCTGAGTGCAAATACTGTTCGGTGGATCGCACCGCACTGGGGCCATTCGGATGAGGTGACCGACCAG
TGGAAGAGTCAAGTACGGCTCTGCTGCTCCATCCTGGCCAGCCAAATAGACCACTTGAGCTCTGAGATCCCGGATTACAT
CCCCAAGATTCTGGACTCTTACCTGGCCATCAGACATGCAGCCGAGTCGAGCACAAAAACAGCAAAAACAGTTCGAAGTC
GCCTGTCATTGCTCTTCCCTACGCAGTACCCCTTCCCGTCGCGGCTAATATCATACCCTGAAGGCCTAATGGAACCGACA
TTAGACGGAAAACCACCGTCGGCAGATCAATCCTCCCAACCACAGTTTGACGAGGCTCTCGTCGAGCTGTCTGCGGTGTT
GTCGGCACTTTCCAATTCCGCCAGTGGAATGCAGCTTGAGATGGCTGACGGGGATCTTGCAGTGATTATTGAAAACACAT
TACGCGTTCATATGAGCATTCTGCGTGGCGAGGCCTTCCCGTCTACTTGGCTGAGTGTGCACATCTTCCATCACAGCTCA
ATCATGCGGACCTTGCAGTATCTGGCGAGCATCCTGCTGGACAGCTTCTTGCTCGATCCCGATGAAGCTGAGGAGTTTAA
CACGGAGCTGTGGAAAATGCTGTTCAGCACACTGCTTATGCTTGTCAGCAGTCCGTCGCTCGCATTGGAAACATTCCCCG
AACAGAAACGCCGGGCGGTGTGGAAGATTGCTGGCGATGTGCGTGAGCACGGTGCAGAACTCCTCCGGCGCACCTGGGAA
GCCATTGGCTGGGATACGGCAGCCGACGAGAGGCAGCGCTACAACCTCACGAAGATGGGCGGCTACCAGGTGCAATACGT
GCCTGCGCTGGTTGGCCCCATTGTGGAGTTGTGTCTAAGCGTGCACGAAGGTCTGCGGCGAATGGCTGTGGAGGTGCTGC
AGACAATGATTGTGAGCGAGTGGACGCTCAGCGAGGACCTGTCGATTATCCAGGCGGAAATAATCGATTACTTGGATCAC
TTTTTCAAGACAAAGCCACTGACGGAGAGCATCTTGCAAAAGCTATTTGTCGGCGAGCTACTAGACCGCTTTGCTGGTTT
GGCTGGCATACCGGATGAGCCTCTCTACGCAGCATTGCGGGAGCTCATTGGCACTGTCGACGAGTTCCTCGATCTCCTGG
TTGCTGTCCATGGCAGCGACGGTGGTGGAGTTTCCGACGTTGTTGTGGCAGGCTCCGGCTCTCCCGGAGAAGCTTCACAT
CTGATCAACCGGCTGCGGCTGATGGAGTTTCTGCGTGATATGCAGAAGGAGGAGATGTTTGTCCGCTACGTGCACCAACT
TGCAGATCTGCAGGCAGCGTCTCGCAACAACGCAGAGGCAGGTCTGGCTCTGCGCCTCCATGCCGAGCTATACGACTGGG
ATCCGTTGCGGACGGTGCCAGCTCTGTCGGACCCTGCTTTCCCTGCGCAGACACACTTTGAGCGCAAGGAGCGGATCTAC
TTTGACATGATCAAGCATTTTGAGGAGGGCGAAGCGTGGAGCAGCGCCTTGGCCGCGTACAAGGAGCTTCAGGTGCAGTA
CGAGACGAACATTTACGACTTTTCGAAGCTGGCTCGGACGGAGCGAGCCATTGCGACCGTGTACGAGACGATTACCAAGA
GCGACCGCCTTGTGCCAAAGTACTTCCACGTCATCTTCCGTGGTTTGGGATTCCCATCCAGTGTGCGTGACAAGGAATTT
GTGTACGAGGGCTCTCCCAACGAGCGGACCAGTGCGTTTACGGATCGCATGCAGGAGCAGTACCCGGCAGCGCAGATCGT
CGTGGTCTCGTCGTCTACTGCAGCAAACTCCCGCCTAGGCGGTGGTATCGTTGTCTCGGGAGCTAATTCGACAGAAGAGA
TGCTCGACGACATTGTGGAGGGCCAATTCCTTGTTGTCTCGGCCCTGAGCCCACACCGCGACTTATCTCACCAAGTCTTT
CAGCGTGCTCGCGTACCCCAAGTGATCCGCGATTATTTGGTGTCGTCGCACCCACAGACGTTTTCGTTTACGTCTCGTCG
CCACCTCAGCGGACCGGTCAGCGAACATTACGTGGACAAGACCGCTTACACGACGGCGGAATCGTTCCCAACGATCCTTC
GGCGGAGCGAGATTGTGTCGGTGGCGGAGGTGCGCCTGTCAGCCAAAGAAGCAGCACTGGAGCGGACGCTGCGCAAGACG
GCGGAGATCACGGCAGTGGAGAAGAAGATGGTCGATGGGGACAACTCGCCCGAAACAGTCAAGCTACTATTGGATGCGAT
CAGCATATCAGTGAACCCCGAATCAGAGAACAGCATAGTGGGATACCGACGACTTCTGCCGACGGCCCGTAGCAATGGGC
ACAACAGCGACGAAGAACAAGCAGGCGAGGGAAGTGTGCTGGAAGATACCGAAGACGCCGAAGAGACCGAAGACGTAGAA
GATAGTGAGGCGCCGGAGCTCGATCCCCAGGAGATTGCGATCAAGATGGCCCTGGTGGACCATGCCATGGTGATCAGACG
TTGTCTGGCCTTGGCTTCACGATCTACTAATGAGAGCTTCTCCGACTACGCCGAAGGTCTCACAAGGTGTAAGTTTTCAC
AGCTTTTCCCTGACTGAATCTCATTCTAATGCGTATGGCAGACTTCGAAGACACGTTCGCGCCCGAGATTGCCGTTTTCA
CACCACCACCCCCCGTGGTCCGTGACGCAGCAGCAACCTCGCCAACGTGGTCACGGTCATCGCCAATTGAGTCGGCACCA
CGACGGAGTCCTGAAGCGGGTACTGTCGAGCGTGGCCACGCTGTCGGTGCCAGCGTCAGCTCTGGCTTTCTCGGTGCAGA
TGTGGCCATCGAAGAAGGCACAGCTGTGCAACCAGTGGCGCTTCGACCGGGTCGTGGCGCTCGACTCTCCTTCTTGCCGG
GCAACCACGGGCATCGGAAGCGGGACAGTATGCCTCTCTCCAGCATGGAGAATGTGCCGCAACAGCGGAAGGGCAGTACT
GGTGGCGATGCGGACACGATGAGCGAGAAGAGTCATCAGAGCCACGGCCGGGGCAAGGAGAATGTGAACCGGCACAGTTT
CTTCCGGCCCAGCTTGGAAAGGCCGCGCCTGCCGATGATAGAGACCACTGTGACAGCCACGGCGACGACGGAATCGGTCG
GCAGGTCCAGCAGCAGCCTGCGGCGGCAGCCGACTGGTGGCAATGGCAGCAACAAGATGAACGACTGGTTCTCGGAAAGC
GGGTTGCGGAAAAGCCTCGACCGGGGCTCGACAGGCCGGAAACGAAGCACTAGCGGCAGCAGAACGGTGACGAGCGGTGG
CAGTGGCGTGGAGGCCGGTCGCGTCAGTGGAGACGGCGGCAGCGGTGGCTTGGCCAAGAAGAACAGCGTGCGCAAACGGC
TAAGCATACTCAAGCTGGGCAAGAAGTCGAGCAAGGGCAGTAGCATCATGGTGGCTGTGGACGAGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62