GenePrediction:GLEAN_2102 Details

Name: GLEAN_2102
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:727673..728476 (+ strand)
Length: 804
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:727673..728105 (+ strand)
Length: 433
Type: CDS
Source: GLEAN
Position: GCSC_108:728238..728476 (+ strand)
Length: 239
>GLEAN_2102 class=GenePrediction position=GCSC_108:727673..728476 (+ strand)
ATGTCCACCTCGTGCGTTGGCCAGATGATGGATGACGACAGACGGCAGACAGAAATACGAGGATCGGGACAGCCGAAGCT
TGGTTGTCCCGGGTCTGCGGAAGACAAGGTCGGACCAGCTGCAGCCGCTCTGCACCATGAAAGGGCGCAGACATTGCGCT
CGTCCACAGCCGGGAGAGAGAGCGATTTGCTCTTCACGCGCTCCTCGCCTTTCCATCCACCAATCCCAGCCCAACAGCCA
GCTCTTACCTCTGCAACGATGGTCTCGCCCAAGTCTCTCCTCCTCTTTGTCGTCGGTGCCTCGGCGCTCGGCATCAACTG
TCGCGGCTCCTCCCTGTGCTCCGGCGAGGCCGGCGGCAAGCTCAGCAAGATCCTGTCAGAGGTCAGAGGTGTCATCAACC
AGGGCCACGGCAACCACCGGTACAATACTGGCGGTGCGTAGTACTACATTTCTTCTTTCTTCTTTCCTCTTTCCTCTTTC
CTCTTTCCTCTTTCCTCTTTCCTCTTTCCTCTTTCCTCTCTCTTTCTTTTTATTCTCTCTTCCTGCCCCTGCTGACACCC
ACAAGTCCAGATAGCCTGCGCCTCGGCCAACTTAGGCAGCTTCTGCGCCTTCTACCAGAAAGGCGCCAGCGGCACCGCCA
ACCAGGCGGCCGCACAGCTGCAGAAGCTCATCGATCACGGTTGCAGCGGCTGCGGCAGCATTCCCACCAGCAGCGGCAAC
AACGTCAACAATGGCGAGCTGACCGTCAACTACGTCAGCGCGCCGTGCTGCAGAACTGGAGACGCCTGTGCATGTTCCAT
CTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62