GenePrediction:GLEAN_2105 Details

Name: GLEAN_2105
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:741136..744538 (+ strand)
Length: 3403
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:741136..741193 (+ strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_108:741263..741990 (+ strand)
Length: 728
Type: CDS
Source: GLEAN
Position: GCSC_108:742174..742282 (+ strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_108:742623..742838 (+ strand)
Length: 216
Type: CDS
Source: GLEAN
Position: GCSC_108:743346..743499 (+ strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_108:743670..743820 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_108:743884..744028 (+ strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_108:744096..744152 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_108:744525..744538 (+ strand)
Length: 14
>GLEAN_2105 class=GenePrediction position=GCSC_108:741136..744538 (+ strand)
ATGGAGAACGAAGCAGGCATCCACCAGTGTCCTCTCTGCAAGAAGACCTTTCCTCGAGGTAATACGCTTGTTCGCGGCGC
ATACGTAGGCGTGACAAGGCTCCATTGTGCTAATACAATCACGCCAGAGTCTACACGCAAACGCCACTACTACTACTGCC
GCACCAGGCTGGCCGATGCCGGCAGCTCGCGCAGGAGATCATGCACCACGTGCATACGTGCCAAGACGCGTTGCATCCGA
CCGTCCGATGCGGGCAATGCTGCTTGCGTCCGGTGTGCCGTCCGTGGGATCGAGTGTGATCTCAGTACCGCTTCCAGCCC
ACCACAACCGGCAGAGGTGCCGGACGAGACCGCTTTTGGTACTGTGAGCTCAGTGGCGGAGCAGCTGGTCGGCGCCATGA
CCCTGTCCAGGTACCACGGCCACATCGCGGCGTTCGGTACGATTGAGACTAGCTCGGTGCCTCCGGTTAGCTTCGACACT
GGCGGCTCCGCAGGCGGGAACCACTACCCGCTGGGTCTCAACCCGATTTCGCAATACCCCGTCGTCGAAATCGATGCCGG
CCAGCCGGGGACTGCGAGCCACAGCGAGGTCCAGTTAAGCACATGGAACTGCCTGGCCTCGAACACGCCCCCCTTTGGTC
GCCGTACTTTTCTGCAACCACACAAAGGCCCGCTCGCGGCGCTGGCCGTGCAGATTATCTGCTCCTACCCCACCATGCTG
CTGCGAAAAGTAGCGCTGCCGCCATTCATGAGCCCAGTCATGTTTGAGTGGGCACGGTCGGGAAGCACGCTCCGGCTGCA
GGTCTGTCCAGGCTCACATCTCGACTGGTCCCGTTCGTTCGCGTCTGCTGACCGTGTATGTGGAAGCTAGCCGCTCGTTT
CTTGCTTGAGCATCATCTACTTCTTTAGTACCTGCTCAGAGTCGCGCAAGCATTCTCCTTGGGATGTAGTCAAGATTGAG
CAAGAAAACATATTGGAAAAGGTAACTTACGCATCCCTCCATGACCACGACCGACCTGACAACAGACAGTATAAACAGTT
TGATCGCTGGGAGCTGCTGGCATCCTTCCAGGCCCTTCTAGTCTACTGCATTCTGCGCGTCAAAGACGCCCCGCCTGATC
ATGACAGTCTGGATGCAGCCTTGCTTCGTACTGTAGATGTGTGTCTAGATCTGAACTCGATTAGAGTCTCGGTTGGCTGC
TAACATTCAAAGGCTGTCTTCGAAGCTATCGTCGCTTTGGAGGGTGGCATCGCAAAGCTAAAACTTCCTGCTTCTCTTGA
CAATTCATGGGCAGATTGGATATACAACGAGTCACTGAAGCGGTAAGCAGCCTTCTCGATCTTCAGTGTTGTCGTTTTCT
GCTGACATTCCGTACAGTGCTATTCTCGTTTTCGACCTCCTTAATATCCTCGTCCGATTAACGGCAGATACATATGCATA
CATGACCGCGTGCAGACACATAATGCTTCCTCTCGCACGAAACGCAGGGATGTGGGCCGCTCAAGACCTGGAGACATGGA
GATCAGAAGTGAAGAAGGTCACTGAAAAGAACTCAATCTACGCAGTCTCACCCGAAGGCGAGCTGGTGAAGGTAATGATT
GACGAAAGCTGTCTCTCGACAACCACATCTAGATGGGAAGACTGGACGGCCGAAGTAGGCGAGATGGGCACACTAGTAAT
GACTGTAGGGGCTCTATTAAAACGTTAGTAGAAACTGTTAGTCAAACAATGGCACTATTCAGTATTATCAAGGTTGGGAA
ACTAATTTGTTCTACCGAACTGGTACCGGATGCTCTGGAAGAGCATCCGTATGATGCAGATCTTGCAGGCCTGATGTAAG
ATACAGCGTCGTGCTTAAGTCTCGGGCCCTCGTGGTGCACCAGGGCCAAATAACGGGGACACGCCACAATGACGCGCGCC
CGTTCCAAAAACAATCCACGCTTGCCTAACAACACTCACTGATATGCCTTTCAACTTCTCCTTCTCCATCTCCTGCCCAC
TCCTCCTTTTCCTCAAGTATTGGCCAATCTTTTCACTACTGTACATTTGATTACCATATTCTCCAATGGCGTCTTCATCA
GACTCCAAACCCAAAAAAATCCGCCCAGGCTGTGGCTATGGAAGCATACATGAGGCGCGTGGTTCACGTATGCCAAATTT
TTACATTGGAGCAGAAACTGCATGTCAAAGATGACGACCTCTTAAAACAGTTGGCTATACGGCGCTCGACTGCGGTGCCG
ATGCCTACTACGTGACATCTGTCAAACGACGCCAGTTGATACCATGGCTTGAAGAGCGCAGGGAATGGGAGTCCATTGGC
AAGGGGTATGACAAGATGCGGATCGCAGGCTACCAGAATGAGTGGTGGAATGCGAGCACAATCTGCAATGACATCACCAG
ATTCATCTAGGAGCATGTAGATCACGAAGAGGGCATTCTAGAGCGCTACTCTGGGAGTCCTGCCTTGACCGGTACATACT
AGGTCGCAATACATACTGGCCGTGGTATGACATAGACACAGTTCTGTATCGCAGCTCGGAGAAAGTTCCGCACGTCCACA
GCATTCTCGTGCAGGGCATCAAGCTAACCGAAGAGGATTTGACCTTGATCGAACTCTACACGTTGTTGCAGCCAACGCTA
CGACGCCTAGATGATGGCATGCTCGACACGTTCCCTTTTATTCCGGTACGTTCGTCTCTTCTAAGACGGCTACTTCTATG
TTATCTGTGCTGACTCGTTTATCACTAGATAACTTTAATTTCCATTGGCGAGTGCAAGGTTCGTGTTATCCATGGCGCCT
TTAACTCGAATGAAGGACGCGGCCATTTTCAAGTGTCTCGGCTGATGCACTTTGACGGGCCTGGTAGCTATGAGAATGAG
GACTGGCTTCGAAGTACGTGCTGGCTGGCATAGTCACCTGTCTTGGCTATCACATTAAGAGACCCCATCCGGGCCCATAG
AGGCTGTTCTTAAGATTAACGATCGTTGGTATGGTCGAGAGTTTCGCGCCGTTGCAGGTAAGTATTTACCACACACGCCA
AAGAACGAAGACGCTTGGCAGAAGTTGGTGCAAGAAGGCAAGGCGCCATAAATTTTCAGAGACTAAAAATTGACGAAGCG
GCGGAAGAGTTGCCTGTCCTCCCCTGCTGATACTACTCAGAGACGTGGGAAGGACTAGTACACTACGAAGGGGTCTTACA
GCGCCAAGCCTTACAGCATTTTCAGCGAGAGACGAGAACGTACGACCGACTGCTCGACTTGCAGGACACATGCATCCCGC
AAATGCTAGCACACATAAGCGTGGTTCGGCCACTAGATGACTGCGTGTCCAAAACTAACCAGTACATATGCATCCCAGGC
ATCTTGCTGCAATGCATCCACGGGCTCAGTCTATGGCGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62