GenePrediction:GLEAN_210 Details

Name: GLEAN_210
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:257393..258625 (+ strand)
Length: 1233
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:257393..257606 (+ strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_167:258378..258625 (+ strand)
Length: 248
>GLEAN_210 class=GenePrediction position=GCSC_167:257393..258625 (+ strand)
ATGACACCAATCATCGCGAAGCACGATAACGGATTGCCTGAGGGTGCAGTAGGGGTTATCTACAATCCTCCTAGAGGTGG
TAATACCCGTGCCACAACGGACTTCACTCTCACCAACGGCAAAAATGGCGCTAAGAAAGTCACTGTTTGGGTTGGTCCCA
GCAGCTGGACACCTACGGGACTGCTAAAGGCTATCCAGGTAGAGTGGAAAGACGGTATGACAAGTGTTGGCGGCAACGAG
AACAGAACCGGTTTCGAGAAATACGAATTTGAATTCCGTGATGATGAGACTGTAACGAACCTGGACCTTTGGGCTGGAGG
GCGTGTAGACAAAATATCTATTCAGACAGCCAGGACCACATGGGCACATGGGGGCTCAGGCGGCGACAAGTACCCCCAGA
AGGTGGGGAATGGAGTTTTGCTTGGCTTTAAGGGAACCACCGACGGCCAGGAGCTCGTTACCCTTCTATCTGTATTCAAG
GAGGAATCTGACTAAAGGTATGGTCAAGCTTTATATCTCAGTGTTAATCATGGAACTAATTATATATATCTAAGGTGAAG
GTACGGACAGTTCCAAGGCACGGTACAAAGAGCAGGTTTTACCACGGCTAAGATAGTTTTTTCCCCAGAGGGTTCTATTC
TAGCTCACCTCAGGCCGGTATAGTCAGGAAATGTCTCCCGTATCTAATTTATGCATATAGAAATAGATAGTGCAGAATAA
GCAACAATAACAGCAGCAACAGATTGCAGGCCCACAGGATTCGTAAAGATCGAACTAAGAGATTTCACGGCTCCTACACG
GTCCACATGCAGCTTAAGACAGTGTCTTGTAACTCATTGCAACCTAGTTAAAGATAAAACCACTATACTACTGCTATCAC
GCATTTTACATTGCACGAGTGATGCCAGCGCTCCCGGGCTGCTACCACAGTTAGCATGGTGCTAACTAAAGTTGCCTTGC
TTGGTGTTAATAAGTTCCGGTCCAGACAATAGCGTCGGCGTCGGCGTCGGCGTTGGTATCGTCTGGCTTGCCGCTGCCGA
AGACCTCGAGTACGAAAAGGTCTGGCTAGAGCTCCTCGAAGAAACAGCCGAGCACCTGGACGGCGACCTGCGAGTCGATG
CCAAGCTTAACGAGCGGGACGTCATGGTCAACCTGGCCGTCCAGCCGGGAGATCATGGCGAGCTTGGCCGATATCTTGGC
GCCAGCCAGCTGCTCGTGGGCAAGTCGAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62