GenePrediction:GLEAN_2110 Details

Name: GLEAN_2110
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:790208..792451 (+ strand)
Length: 2244
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:790208..790913 (+ strand)
Length: 706
Type: CDS
Source: GLEAN
Position: GCSC_108:790983..791103 (+ strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_108:791154..792174 (+ strand)
Length: 1021
Type: CDS
Source: GLEAN
Position: GCSC_108:792230..792336 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_108:792406..792451 (+ strand)
Length: 46
>GLEAN_2110 class=GenePrediction position=GCSC_108:790208..792451 (+ strand)
ATGCTCAAGACGCTGCTGCTGGCCGCCACGGCCGGCCTGGCCCTCGCGAGCCCCGTCAGCCGCCGCGAGGTGCCCGCCAC
CCACACGCTGCACGAGCGCCATGCGCCGCACTGGGCCGAGCACTGGTCCAAGCGGTCCAAGGTCCCGGATGACGCCGTGC
TGCCGATGCGCATCGGCCTGACCCAGCAGAACCTGGCCGCTGGCCACGACAGGCTGATGGAGATCTCGACGCCCGGCTCC
GCCAACTACGGCAAGCACATGACGCCCGAGGAGGTCCACGACTTCTTCGCTCCCTCTGCCGCTTCCGTCGACGCCGTGAC
CGCCTGGATTACCGGCCACGGCATCGCCGCCGACCGCATCGGCCTCTCCGTCAACCGCCAGTGGCTGCAGTTCGACGCTA
CCACTGCCGAGGCTGAGGACCTGCTGTACGCCGAGTTCTACGTCTTTGAGCACGCCTCTGGCGCCAGCGACGTCTCGACC
GAGGCCTACCACGTCCCCGAGGCCGTCCGCGAGCACATCGACTACGTCACCCCCGGCGTGCGCCTGCGCGTGCGCCGCAC
CGAGAAGACCACCACGCTTGGCAGCGGCGCCGTGCGCGCGCGTACCAACTTTGGCGGCGTCAGGCCCTTGAAGACCAAGC
TGTCTAGCTTCCCGCACCCGAACTCGAGCTCGTGCTCGACCTACGTGACGGCCAACTGCACGCGGAGTATGTATCGCCCA
GCTGGCCCATCCCTGTTGCCTGTTGCCTGTGCCGTCCTGTGCTAACGCCCTCCAGATCAGTACAACATCCCCGTAGGCAC
CACGGCCGCCAAGGGCAACGAGATGGGCATCTTTGAGAGCCTCGACGTCCACTACAGCCGCAACGACCTCGACGTCTACT
TTAGCACGCTATACCCGTACGTTTTCTTATTTTTGGGGGGGGTTTATTTCTCCGGCTAACCGCCAGGCACATCCCCAATG
GCACCTACCCCGAGGAGCGCCTTATCGACGGTGCCATCGGTGCCACTGAGGACACAACCGATTTCGTGCCGATCGAGCTC
GAGGCGCCGCTAGACTTTGACGCCGCCATGCCGCTCATCTACCCCCAGGGCGCCGTGCTCTTCCAGGAAGACGACGAGTA
CTACGCGACACACGGCAGCACCTTTATGGGCTTCTGGAACACCTTCCTCGACGCCATCGACGGCAGCTACTGCACCTACT
CGGCCTTTAACGAGACCGGCGACTGCACCGACCCGGCCTGCAAAGACCCTGTCTACCCAAACCCGAACTCAGGCGGCTAC
AAGGGTAAGCTGCAGTGCGGCGTCTACACCCCGACCAACGTCATCAGCATCAGCTACGGCAACTCTGAGGGCTACTGGCC
CGACTACTACATCAAGCGCCAGTGCAACGAGTGGCTTAAGCTCGGCCTGCAGGGCACCACCGTTCTTATGTCTAGCAACG
ACGACGGCGTCGGCAAGTGGTGTAACGGCCCTAGCGGCAACGTTTTTGACCCCGACTTTGGTGCTACCTGCCCTTATATC
CTTGCCGTCGGCAGCACCGAGTGGAACCGCGCCGCCGATGCTACTGGCTCCGAGGCCCCTAACGAGCCGCTTGTCGAGGT
CGCCACCGCTCGTTTTGCTAGCGGCGGTGGCTTCAGCAACGTCTTTGATGTCCCCGACTATCAGAACGATTCCGTCGCCG
CCTACTTCGCCCAGGTCGAGAGCTCTCTGCCCTTCCAGGGCTACAACCACTACGTCCATGACGGCAACTTCTCCAACGTT
ACCGACGGCCTCTACAACCGTGGCGGCCGTGGCTATCCTGACGTCTCCGCTGTCGGCGATCGCCAGGTCATCTACGCCAA
CGGCTCCTGGTGGCTCTATGGCGGCACCAGCCTTGCCGCCCCCGTCTTTGGCTCCGTCCTCACCCTTATCAACGAGGAAC
GCATCGCCGCCGGCAAGAAAAGCCTCGGCTTCATCCACAACATTATCGTGAGTCTTTTCCCTGCCCGTCTGAGCTATGCT
AGAGGTCTCACACGCGTCCCAGTACAAACACCCCGAGGCGTTCAACGACATCACCTCCGGCAGCAACCCCGGCTGTGGCA
CGTCCGGCTTCCCGGCAGCCAAGGGCTGGGACCCCGTTACCGGCCTTGGGTAAGACTTCAGACTTTCTTCTATCCCACAC
ACCTCTACCTGTATACTACACGAGGTTAACACCATCAGGTCGCCCAACTATCCTAAGCTGCGAGAAATATTGCTGGCTGC
CTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62