GenePrediction:GLEAN_2111 Details

Name: GLEAN_2111
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:801303..803026 (+ strand)
Length: 1724
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:801303..802019 (+ strand)
Length: 717
Type: CDS
Source: GLEAN
Position: GCSC_108:802079..803026 (+ strand)
Length: 948
>GLEAN_2111 class=GenePrediction position=GCSC_108:801303..803026 (+ strand)
ATGGCCGAAAAGCATGACGAAGCCCACGAGGCTGCAGCGAATGCGCCGGACGAGAAGGAGAAGGAGAGCACGCGACCACC
AGATGACAGGATAGTGCTGCAGCCGGCAGCCACAGACGGCGACACGACCGCGCAGCCGGTTGAGGGTCCTGCTTTCTCGG
CCTTTTCGCGCCGGACCAAGCGGTTCCTGCTGCTGATGACGGCCTTTGCCACGTTCTTCTCGCCCTTCTCGTCGTTTATC
TACCTGCCGGCCATCACGCCGATCGCGACGGCATACGGCCGCTCGATTGCCGACATCAACCTCTCCGTCACGCTCTACCA
GGTCATGCAGGCCGTGGCGCCTCTCTTCTTCGGCGACCTCAGCGATCAGATCGGCCGCCGGCCCGTCTACGTGCTCACCT
TTGCCATCTACCTCGGCGCCAACATCGGTCTGGCCCTCCAACACGGCTACGCCGCCCTGCTCGTGCTGCGGGCCCTCCAG
AGCACCGGCAGCAGCGCCACCGTCGCCATCGGCAGCGCCGTCATGGCCGACTTCGCCACCAGCGCCGACCGTGGCGGCTA
CGTCACCGCCGTCCAGGCCAGCATCATGTTTGCGCCCGCCCTGGCCCCCGTGCTCGGCGGCATCCTAACCCAGTTCCTCG
GCTGGCGCTCCAACTTTTGGTTCCTCACCATTGCCGCCGGCGTTTTCTTACTGATCTACGTGCCCTTTGTGCCAGAGGTC
GGTTCCTCTGCTAAAGGACGAACAACTTTGTCCTTTTCTTTGCTGACGTAATCTAGAGTGCGCGCAACATCGTCGGGGAT
GGTTCGCTCCCACCTCCGGCACTGAACCGCAGCCTGCTGGCGATGCACATGCAGAAGAAGCAGAGACAGAGACGGCAGAA
CCCAGATTCAGAGGCGACGGCATCGACGGAAGCAACACCACCTACACCACCACCATCATCACCACTACCCCCTCGCAAAC
ACAAGATCCCCATCCCCGACCTGCTAGCAGCCGTGCGGATCGCGTTCGAGAAGGACGTCGGGCTGCTGCTGCTGTTCATG
TCTCTGTTTGTCATGGCCAACTACACTCTGTTGGTGCCGCTGCAAGACGTGATCCGACGACGATACGGTTTCAACGACGT
CCAGGTCGGCCTCTGCTACATCCCGTTTGCGGCCGGATCCGGAGTCGGCTCGCTGGTCACTGGCCGACTTCTCAACCGCA
ACTACGCGCGTGTGGCCGCCAGCATCGGCGTACGGCCGGACCGCAAGCGTGGCGACGATCTGCGCCACTTTCCCATCGAA
CGCGCCCGGCTCGACGTCATGTGGCCCTGGCTGCTGCTCGCTGTCGCCATGACGGCCTCCTGGGGCTGGGTTGTCGACGC
TGGCACCAGCCTGGCTGCTCCCCTGGTCGTGCTCTTCTTCGCCGGCGCCGGCCTCAGCGGACCCATGTCTGTTCTCACTA
CCCTCCTCGTCGACCTCTACCCCATGAACCCCGGTCGCGTCTCGTCCACCTTCAACCTTACTCGCGCCGGCTTCAGCGCC
GTCGGCACTGCCGTCATCCAGTACATCATCGACGCTTGGGGCTACGGATACACCTACCTCTTCATGGGCCTCCTCGTCCT
CGCCGCCAGCCCCGCCATTCTCGTCGTCCGCCACTACGGGCCGCGCTGGCGCGAGGAACGCTACCTGCGCTTCGAGCGCG
CCAAAAAGACCCAGGCCGACAGAGTGGATGTCGACAGAGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62