GenePrediction:GLEAN_2117 Details

Name: GLEAN_2117
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:864296..865541 (+ strand)
Length: 1246
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:864296..864317 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_108:864579..865039 (+ strand)
Length: 461
Type: CDS
Source: GLEAN
Position: GCSC_108:865199..865404 (+ strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_108:865463..865541 (+ strand)
Length: 79
>GLEAN_2117 class=GenePrediction position=GCSC_108:864296..865541 (+ strand)
ATGGACGAGTCATGTGTTGGTGGTATGTATTTCTTCGTTCATAGCCAAAATGCTTAAATTGGCAGAGACCCCGGACATTT
TTTCCTGAAGACAAAGCCTACCACCCATCATATAATAACTCAGTTGACATCACCAATCTCATCTGTCTAAGACTGTTATT
TATAGTACAAATTTGTCAAATTAGTACTTATTTCAACAAACCAACACATATTCGTGATGCCTTGCTATTGCCGTGGCTGC
CGATGGCGCGTTGTAACGAATTTTTATGGACCAATTCCCACAGGGCCACCCATTGCAGAACAGCCCATAGATGATGGAAG
AGAGTACCCCGAGGACGATTTAGAGGAACCGGATGGCTCGTGTCTTCTTCCGCTAGAAGAAAGTGACTCCGACACGGACG
ACGGGTTTGTCTTGGACGACGAAGAGCCTGTAGCAGATACCAACGCTACTTATATCCAGGAGCCTATTAACCCCTTTGAA
GGTTGGAGCCTCGAAGATTATTTGTCGTACCTAGAGGCAATTGAGGCCGGCTATGTCGCTGGAACCGTGAATGGACGGGC
TGTCATATATGTCGACAGCGTGCCGAACTATATCGCCGATCATTATTTCTACTGTGCGGCCTATGCAACTGCACCGGTGT
ATACATTATATCCCAGAGAGGACGAATCGATATTGGAACAGCAGCTAGATGAGCAATCAATTGCTCGTGGAGTACGCATT
CGTGAACCACCATCTTACGATATGGTAAGCATAGCTCTTTCCTCATATCAGGTCGATTTATTGACACCATCCCAGGTCAG
GGAAGAAAACATTAAAAATTGTGGAATTAAATTAATGGATAAATGGGACGTGATGACGGATAGAATGAAAGATTTGTGCC
GTCTGGACTTTCTATACTGGCAGCTTCAGCAGCGCAAAAAGAAGTCAGCCGAAATGAAGGCTGCTTTGGAGAAGGAAGAC
GAAGTGTGGCGAGCGTTGCACAACGAGTGCATGCACCGAATGGCGCGCAAAAGAATATTGTTATTCATACCGCTGTACGA
GAAGCTTTATCGGTGTTACCATGGACAAGGCTATGTGATGGGCGCGGTCGCACACGAGACTATGCTAATGTGAGTACACC
TAGTCCAATCAAAGGTATAACATCAGCTGACATTTTTTTGCAAATAGTACGATGCCCTTGGGCGAGTTTAGCAGAGAGCC
CCAGGCAGCTCCTCCAGGGTACTCGACGTTGTCCGACGATGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62