GenePrediction:GLEAN_2118 Details

Name: GLEAN_2118
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:869895..875402 (+ strand)
Length: 5508
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:869895..872761 (+ strand)
Length: 2867
Type: CDS
Source: GLEAN
Position: GCSC_108:872831..873551 (+ strand)
Length: 721
Type: CDS
Source: GLEAN
Position: GCSC_108:874288..874421 (+ strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_108:875345..875402 (+ strand)
Length: 58
>GLEAN_2118 class=GenePrediction position=GCSC_108:869895..875402 (+ strand)
ATGGAGGTCTTTATGACAAACCTGCCCGCGCAGGGCAACTTTGGAGATCGCGTGCTCCGCGAACAGCTCAAGCCTTTTAT
GAAAAATCTGGCCATTGCCGAGAAATCATTTAACTGCGAAAAGCCACTGAACCGGAAGCACGGCACTATAACCTTCCTCA
ACGAGTCCGACGGCCGCAAGTTCCTTCAGTTCTACGGCGAGTCCAAGCTGCCCCACGGCCGCACCGCCTCGCGCTTGAAA
ATCCTCGGTGCCAAGGTCTTGTGTCGGCTGAGCCAGCGCCAGCCAAACACCTTCACCCTGAAGCACCTTAGGGCTGAGGT
AGACAAGCCTAACCGCCCTCCAGAGGAGCGGCGTGGCGGCTATGCGGACTTTCTCCCCTCATTTAAGCTTCATTCTCTCC
AGTGCGGATACTACCGCTACAACCAGGGCCGCCTTGAGTACGTCCCTGAGATGAAAGAGGTTGGAGAGGGAGCGGTGACG
TTCGGCAAGCGGTATCTGACCGTCGACATTTTCCGCGATTCTGAGTTTGTCAACGAGTCCAACCTGCTGTACATTCCTCT
CGGAACCATCTACGAGATCGTATGGTCAGCGAACGGTGAACTGACCCTCACCCTCCAGTCCGCGCCGTTCATCTTCGTCG
ATACCGAGTTTATGCAGCAAAGTGGAAGGGTCCGCCAGACACAGCTGAGCCCCAAGCATGCTGAGGTCGGGGGCACCTGT
CTAATCTACCGCATCAACGTCGACCCCGTGCAGCTGCAACGCAAAATGGATTACCTTAACACTATGCTCACCGTCACGCG
CTACGATGTTAGCAATCGCCTGGCGCCGCCCATCGCAGACAGCCTGAAGAAGCTCCACGCCAAGCTCGCTTCCATGTTGA
CGTCCTCGAAGCTGCCCTTTTCCATTCTTTTTCAGCTACAAGCACTGGCTTGGAACGCCTTCCTTTACCCTGACACCGTC
GCTGACCTGGCCTCAGAGCTCGTTGTGCTCCAGAAAACAGCACCTGTGTCTGTCGACGCCATGAAGATGCTATTTACCGA
TATCGGCTGGCCTACCCCCAACGACGCGGACCCCAGCCAATTCGAGGTTCCCGCGCTGGTCGCTCACCTCCTCAAGAAGG
AGAGAGAGATCCGAAGCGGTTACGCCATTCGTGAGGGTCTTTTGAGCCCAAGTGAGAATTTGGCGCCCATCTGCCGCGTA
TCGGTCACGCCCACCCGAATTCTGCTGTACGGCCCCGAGTTTGAGAAGAAGAACCGAGTGCTGCGCAAATTTCCCAATCA
ACACGATTGCTTCATCCGTGTACAGTTCTGCGACGAGAATGGGGACAGTCTACGCCTCCTCGGAAGGCGTACCAGCTATG
AGAAAGTGTACAAGCGCTTTATCGACATCATGAAAAACGGCATACAGATTGTGGGCCGCACATACAAGTTCCTCGGCTGG
TCGCACTCTTCCCTTCGCGCGCATAGCATGTGGTTTACGGCGCCATTTATTGACGACACTGGCCGCCTGCAGACGCACCT
AACCATCATCTCGACTCTGGGCGACTTCGCCGGCATCCGCTCACCGGCCAAATGTGCCGCTCGCATTGGTCAAGCCTTTT
CGGAAACCCCCTATGCGGTGCCGCTGAGCGAGCACAAAATCAGTGTGATGTTGGTAGATGACGTCAAGTCAAAGGATGGA
AAGCACGTTTTCAGCGACGGCGTCGGGACCATCTCGCTGGACGCGGCCGCCGCTGTCTGGAAGTACGTGCCCAAGTCCAA
GAGAAACCCGACCTGCTTCCAGGTACGGTACGCAGGAGCAAAGGGCATGCTCTCTCTGGACACGCGCCTTCAGGGCTCGC
AGATCCTGTTGCGGCCGTCCATGATCAAGTTCGAGAGTAATGAGACGGAAAACCTGGAGATATGCGACGTGGCTAAGGCC
ATGCCACTGTATCTCAACAGGCAGATGATTAAGATTCTCGAAGACATGAGTGTGCCGCGCAAGTGGTTCCTGCGGCTGCA
GAACGACGCGTTGCAGCAGCTGCGGTTGATTGCTTCCAGCGCCTACAACATGGCCTACTTTCTCAAGCACCAGTCTGTCG
GCACGTCGATCAAGCTGCATAAGTTACTGCTGTTGACTGACAAGCTGGGCTTGGACTACCGCACAGAGCCGTTTCTGCGG
CGTGCCGCCGAAGCGGTGGTCTTGCGCGAGCTACGGCTGTTGAAGCACAAGGCACGCATTCCCGTTCCGTTTGGCATCAC
GCTTTTTGGCGTCATGGACGAGACGGAATTCCTGGCAAAGGGCCAGGTGTACGTGACATTCGAGACGAAGCAGGGCTTAA
AACCACAGCGGTTCGAACAACCGCCCGGACACGCGGTGTACTTGCTGGTGACGAGATCGCCCGCACTACACCCCGGCGAC
ATCCAGTGGGCTTGCAACATGATCCCGCCAGAGGGGCATCCTCTGCGCGAATTGTCGAACTGCGTTGTCTTCAGTGCCAA
GGGTGCGCGTGATCTGCCTAGCCAGCTGAGCGGCGGAGATCTGGATGGCGACATCTTCAATTTGATCTGGGATCGAGAGG
TGTGTCGGCCGGTCGAGCTAAAGACATATCGCGCCGCCGAGTATGCGCGGGTTCCGCCGCAGAACATCTGGCGAGAGGTG
CAGACAGAAGACATTGCCCAGTTCTTTATTGATTTCATGAAGACGGATCATCTGGGCACCATTGCGACGCGCCACATGAT
TCTGGCCGACCAGAAGGAGATGGGGACGCTCGACAGCGACTGTATCGCGATGGCGGAGCTGCACTCGACAGCGGTGGACT
TTTCGAAGACGGGCATCCCGGCAGATCTCAATGAGCTCCGGCGTGCATCCCCGTTCCGGCCGGATTTGTGAGTTGAAGCT
GTGTGGGATGGGAAAGGGACGACGGGGAACTGTGTACTGACAAATTCTTTCTGCAGCCTGGCCCCAGGGTCGTTGGTCTA
TGTGCACAACAAGGCAGACATCGAGTTGGAAAAGTACGTTGCGAATAACGAGCGCGATGTGCACGCCGAAGCGCTGGATG
GTCCGGCACACAAGTACTACAGGTCAGAAAAGGTTCTGGGAGTGCTCTACCGTGCGGTGGATGAGCGCAAGATCTGGTAC
ACGGACATCCACAAAGGCGAGTCAGAAACGACAACGACAGACGGAACGGGTGCAGGCACGGTGTTGGACAAGCTGCGAGA
GTGGGCACGGAAGCAGTGCGCAGAGCTGGGCTGTGACAGCTGGCATGAACGGCAAGAAGAGGCGGCTGGAATTCGGTCGG
CGTACGAGGACTCGATCCGGTCGATGATGCATAGCAACTCGGAGAATCCGATGCAGCCCATCTCGGAGCTGGAGGTGTTT
ACCGGTGCACTGATCAGCAAGACGGGAGCGCAGAACAATCGACAGCGGGACCGATCGCGCAAGCTGCGAGAGGAGTTTGA
GCGGATCTCGAGCTGGATCACGGGCCAGATGCGGCCGCGGGAACGGCAGCAGGCAGCAGACGGTCGCGACATGCTGGAAT
GGATGGAGCTGTGTCTGGCATGCGCTCACAGCCGCGAGGTGCGGGACGAGGATGAGCGGTGGGGGAACACGCGCAGTGAT
GCGATCCAGTCGTTTCCTCTGGTGGCGATGGCGGCATTGCTGAGGGAGATCGATTATGTGCGGAAGGTTCGGATGGAAGA
GGGCGGCCTGGAGGCAGCGATGGGGCAGTTCTCGCAGATGGGGATCGGGAGGTAAAGGTGAAGAAGGGGAGCTGGAGGGC
AGGGGAAAAAGGGGAGATTGGGGAAGCTGGGGATCAGGAGAGCAGGGGAGCAGGAGAATAGGGCGAGCAGGGGGGGGAGG
GGGAGGGTCGACCGAGGGATTTTGGGCGTCAGTCTGCGGTGAGTTCTGGAGCCGGCAGAGTCGGAGGTGTTTGCGGTGTC
GTGTACGTGGCAGTCTGGAAGCCTGGAGGAAGAAATACTATGTGTCACCGCCTGCAGGTGAGCAGAATGACAGCGAGATA
TGTGCCGGTGCAGCTGGATGTTACAATGGGTCGCAGCGGATGGCGGAAGAAGAGAGGTGTGAGGGAGCGAACGGGGCGGA
TCACTGCGAGCTGACAAGGTGTGCATCCGGTCGGATGCATCTGTCCCCCTTTTTTTTCAATATCGCTATGCAGGAGATGT
CTGTGCGAGAATCGAGAATCGGGCACACATACATGGATGATGTTATAAGTATTCGACGTCTCGACTGATTGCCAGAAGCC
CAATGTGATAGGTTCACGAAAACCGGACGTGATAAGCCGAGATCCTTGCTTCCGTGACGTGGACGTCCACCGCAACAAAA
ATTGGGTGTTCTTGTTAATGGAGAGGCTGCGGAGCGCAGCCTCCTCTAACATGCCACTGCATAATTTATACAGAGGTTAT
CCCCATCGGGGACCCACAGCAGTGTTCTCGAACACGCCGGCCTGCTTCGGGCCAGATCCTCCAGTGGCGGCATGCGTGAC
GAGACAAATCATGCCGTAAAGCCATTGTCGGTGGGCGATGGTGTCATGTGATTGAGGCCGTTCTGTAGACGGTTGCCGCT
GTTGCGTGTCGGGCCTCGTGGCGGTCGTTCTTTCCCTCACCGTCGCTGAGCGCGGTTGTTTGTTATTAATAAGCATGCAT
TTGCCCGCTACTGCAGCGCAGCAGAACCAATATTGGTTGATCATCTTACGAGCCGACGGGGACGGCGAGCCGGCGGGGAG
CCAATGAGACTGACGGCAGTTTGCGGTGGACAGCCATGGGCCAATCCAGCCACCGGCCAGTGTCCCATCAGAGGGCGAGA
AACGAGAGAAAACCGGGCACAGGACAGCGCCGGCAAAGCCGCGGAAGCCGGAAAATCGACCCTACAGCGCAGGAGGACCA
TCGTGCAGACAAGCGGCGGTGGAGCAGGAAGGGGGAGTGGAGGCCGGCGCGTGGACGAGCGACACGATGGGCGATGGGCG
ATGGACGACGGGAGAACTGGGGGGGCGGAGAAAGGCGGCGAGGGTCTCGGTGCGAGCTGCGTCACGCAAGAGGTCCAGAA
CGTCCTGCCAGCAGTCGATGCCAGCAAGCCAAGGACGAAAGCCTCCTTGGGGGCGACAGGAACAAGGCGCTTCCCTCGGC
GGAAAAGACGAGACGGAAACGGGCGAGAAGGGACAAGGGCAGAACGCGCGTGTTCGCACAGCGGCCGATGAGCAGGCGAA
CAAGACAAGAGACGAGGGAAAAGAGACGAGGGAAAAGGCAAGAGGAAAAGACGGTCATGGCGAGCTGCAGTGCAACAGTC
GGTCGGAGGGACCATGGCCACGAGAGACGTCTGGCAGCAGGGCGAGACGGACGAGTAGATAACGACCGTGTGTCCCGGCT
GTTTTCCAGTCGTCTTTCTGGGACGAGCAGCATCTCCTTCTCCTCTCCCATCCTCTCGTTTGCATATACGCATATATCGT
GCATATACAGGCCAGCGGTCTGCACTGTCGTTATCACCACCGGCTCTTCTGTCCTGACGGATCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62