GenePrediction:GLEAN_2119 Details

Name: GLEAN_2119
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:875476..876438 (+ strand)
Length: 963
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:875476..875823 (+ strand)
Length: 348
Type: CDS
Source: GLEAN
Position: GCSC_108:876034..876242 (+ strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_108:876324..876438 (+ strand)
Length: 115
>GLEAN_2119 class=GenePrediction position=GCSC_108:875476..876438 (+ strand)
ATGGCACCGCTCCTCCACTTCGACCTGCTCGACCAGAGGCAGCGACAGCAGCTGCTGCAACAGGCACAGGCACTCGCACG
CACACAGGCTTTCCAACACGCACACGCACCGCCGCCCCAGCAGCCTCCCCGGCTGGCCTACAGCCGCGTCTCGGCGTCCC
GTCCGTCGCAGCAGCAGCTGCTGCACGCACGCCAGGCCACGGTGACGACCACGGCAGCGGCGGGCTCGCACCACCTCTCG
GGTGGCGCCATTGCCGGCATCGTCATCGGCTGCATCGTCGGGGTCCTGCTGCTGGCCTGGATCCTGCGGCTGTGCCTCAA
CCCACCGCCGGCTTGGCGGCAAGCCTGGGTGCGCGATGACGTCGAGACAGCCACCAAGAGCCGCCACTACAAGAGCGGCA
GCTACAGCCACAACACGAGCAAGAACAACAGCACCAGCACCAGCAATAGCAATAACAACGGCAAAAACAACAGCACCAGC
AAGAACAACAGCAATACCACCAATACCAACACCACCAACACCAACACCAACAAAGACCACAACGTCCACAGAGACCAGCA
CCGTCACCGGTCTCCTGCACGTCGTCACCATCGCCATCACAGCGATCCTGGTGATCGTGTCGGCAAGCACAACAACACTG
CCAACACCCACAGACACACTCGCTCGGACGCTCGCCGTCCCGAGATCGAGATCATCCAGAAGCCGACGCCGGTCGTCGTG
CGGCGCCGCAGCACCAGCCGCCGCCGGACAACCTTTGGCAAGGCCACGTACGCACCGGCACCACGGCCATCGTCGTCGTC
GTCGTCGTCGTCACAGTCGCCGCCACCACCGCTATCTGGCCGTCGCAGCACCGCCGTGCGGGCATCCCACGGCGAACGCA
AGGCAGACGACGGCCCATCAGAAACAGTGGAGCGGGGCCGCAAACCGAGACGGTTCTACGAGACCTATAGCGGAAGGGCG
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62