GenePrediction:GLEAN_211 Details

Name: GLEAN_211
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:259107..259976 (+ strand)
Length: 870
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:259107..259173 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_167:259237..259976 (+ strand)
Length: 740
>GLEAN_211 class=GenePrediction position=GCSC_167:259107..259976 (+ strand)
ATGCCTCGCTTTGAGCTCGAGTATCCCAAGGAGCCGTACAGCACGGTGCACCGGAAAAGCTCACGAGGTAAGGCTAATGA
TAGTCATCAGCCTCGCACAACGCTGCTAACAAGTCGTTTCGCCGTACCAGCCACGTATGCGCTCAAGACAATCCACGGCA
TCGTCAACGGCTCGCAGCTGGTGCATGTCTCTTTCCAGGCGCCAGACGCACCCTTCCCGGCCATCCTGCCGATGATCGGA
CAGATGGGCTCGTTTGAACGGCCCAGCGCCGACGTGGCCGACGTGCTGGATCTGTATCTGCACGGGTACGTGTCGTCGCG
GCTCATGAACATATCGCGAGGCGCCGAGTCCTCTGGGTCCTCTCCCGGCCTCCCCATTGCTGTCGCTGCCAGCCAGGTCG
ACGGCCTCGTGCTGGCCCTCACGCCCAACGCGCACAGCTATAACTACCGGTCGGCCGTGCTCTTCGGCCACGCCACCGTC
GTCACAGACGCATCCGAGAAGCTGTACGCCATGCGGCTGATCACAGACGGCATCGTGACCGGTCGCTGGGATGGATCGCG
CGTGCCGCCCAATGCGGCCGAGATGCAGAGCACGTCGGTTCTGCGTGTGCGCATCGCCGGCGGCAGCGCCAAGATCCGCA
CCGGGGGCCCGCACGACGACCGCTGCGACCTCGGCGACGAAGCCGTGCTTGATCGCGTCTGGACCGGCGTCCTGCCCGTC
TACCAGACCATCGGCGCCCCTGTCGCCGGTCCCTACAACCGCGTCGCTCAGGTGCCGGATCACGTGACCGCCTTCCGCGA
CGAATTCAACACTGATGCTGCCGAGCTCGCCCTCGAAGCTTTGAAGGAGCCGGGCAAGGAGAAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62