GenePrediction:GLEAN_2120 Details

Name: GLEAN_2120
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:890891..896073 (+ strand)
Length: 5183
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:890891..895087 (+ strand)
Length: 4197
Type: CDS
Source: GLEAN
Position: GCSC_108:895283..895852 (+ strand)
Length: 570
Type: CDS
Source: GLEAN
Position: GCSC_108:895915..896073 (+ strand)
Length: 159
>GLEAN_2120 class=GenePrediction position=GCSC_108:890891..896073 (+ strand)
ATGTCAACAGACGGTAGCAACGGCCAGACGGCGGAAGCCGGCTCTGGCCTGGAGTCACTTTTGGCTCAGCTGCGTCGCAA
GTCGAACCAGGACACCGCAGGCTCTGCTGAAGTGCCACAGACGCATGACACCTTAGCTCAAGTGTCCACCTTCCGCCCTT
CCAACGAGCTGTACTATCCGCAGGAGCGGTCGGACTCGCCCAGTGCTCCTCCATCCTTTGCTGCACCACAGCCTCCAATG
CACATCCCCCAGGGTGTCTCCAATTCTCTTCTTCCTTCTGCACCGACCCCTCCAGTCGGTGGATTTCCTAATGCTCAGTT
CCCACCGTTCCTGTCTTCTATTGGCTCGGGACGGCCCAACAACGAGCGGGCGACTAGCTCTCACCTGCTCAACCTTCTCA
AGTTCAGCGGACAACACAATGCTTCCAGCACCCTCACCCAGTCTCCCGCGGTACCCTATAGCGCGGATCCTCGCGAGCCC
GACGTCCGGCACCCGGTCACGTCGCTCCCTTCCAGCATGATCCACGCGCCTGCCCCGGCGCCATCTGACCCTTCCGGTCT
TCTCGCCGCCCTTATGCAGGGTGCCCTGAAGGATGAGCCGCCCAAGGCGGAGCCGCCAGCACCCGGCTCGGCGTCGTGGT
CGTCTACTTCGCAGTCGAATGAGACGCAGCAGTACCTGCTAAACCTGCTGAACCGGCCGAAGCCCAGCCAGTCGAATGAC
ACCTTTTCGACCGAGACATACAACTCCAACGGGGCGTCGCCCTTGTCCGGTGGTGGAGATACCCAGAACAGCCAGCGAAG
TGCTTTCCATTCATTTACAGAACCCGGTGTCACGTCTGCTGAAAATGCGGCGTCGTCTGCTCCTGTCGTGCCTGGCAAGT
TCTTGGAGTCTCCGGTCCCGTCGACCACAGACAGCGTTACGTCTAAGCTGCCGACAGCCACGTCGTCGACGACGACTCCT
CTTTTCCACCACCATGACCCTTTTGATGGTCTTGGTGTCTCAACACCCGCCAGTCATGCCTCCAGATCTTCAGTTACACC
TGGTGCCTCTGGCTACGTTCATCCCACCCCACCTCAGCCCCAGCCACCTCAGCACCAGCCAGTGGCAGCCGCTGCAGTGC
AGATTCTGAAGAAGCCTACGCCGCAGCAGATTGCAGTTGAAAACAAAGCACAGGCCAACATTCTGGAGTCTTTCCTCTCA
AAGCCCAACACAGCTGGCTCTCCGTCCCCAGGCAATGCGATGTCCTTTGAGAGTGCAGAGAATGATCCCAAAGACGTCGA
TGTCACCGATGCCGAGGACCAGCAGAAACAGTCTGTGGACAGTGAAGACGGCACGGCCGTTAACGGCGATGATGTCAGCG
AGATTGAAGGCGGCAAGAAGCTCATCGAGGCGGACGAGAAGGAAAATGATCAGAGCCAGGATGCTGATGCGTCTTCGGAT
CCGGTTAAAGAGACTCCCGAGGCTGACAATGAGGCTGGCCAGGCTGCCGTGGCCGACTGCTGGGAGAGTGCCGATGCGGA
CGGAGACGAGGCTATTGTTGTCGAAGAAGCCCCTGCCCTCGTCAAGGTTTACAATTTCCCTATGAAGCCATGGATCTCGA
TCGAAGTGCAGGACGATGACAGGGAAATGCGCCCCACGTTTCACGAGGACTCCATCCTGGACATTGCGCGGCTCAAGAAG
GAGTTCGACCAGATTGATAGGAACTTGGTTGCTGCCTCGGAGAACTACATGGCTTATGGCATGTCCAAGGCCGGCGGTCT
TCGCGTCATCCGGCAGTCGGACGGGAGAGACGCGAAGCTCTTTACCGACACGAAGGACCGAATTTTCAACGTCGCTATGT
CGTGCAGCAATCCGGATGAGGGGGCCGTTCCGAAGGACTCCATCATCGGTACAGGTATCAGTGGCACGGTGTACTGGGTC
CAGGTCCGCGATGGTGACAAGGATCATCTCGAGTATGCCCACCCGGAGCTGTATGGCTTTGCCCTTCCGCCGATTGCGTC
GCACGAGGGAGATGCGCCGGGAGGTGTTCTCAAGACTCGGGCTCGCACCTCTTCCAATCACCCGGAATATTTTGCCGTCG
GCCGGGGCAAGTCGATCAACGTTGTGTGGCCAAGCTACATAATGAAGAACAACCTGTTCAAGCCGGGTCATGACCGTGTT
GTCGACACGGAGAAGCTGGCGAAGCAGTGCTCGCTGAAGATCAACACTGGCAAGGCCGGGAAGGACTTCACATTCAGCCA
GGACGACACCGTCGTCGTGTCTCTCGACAAGTCTGGCAAGGTCAAGTTCTGGGACGTCCGGGACCTTACTGCCACCAAGG
AAGGGTCCGACCCGCGGAACCCGCTGCCGGCAAACACGTTTATGGAGGTTGCCGAGCCTCTCATGACGCTCACGACCACG
CCCGAGGGCGAGAAGGCGTGGCCAACATCTGTTCTTCTGCTGGATAAGCTGAGGCCGTACCAGAAGGGCTGTGCTCTACG
GTACATGATTGTGGGCATGAAGCAGAACCACACGCTGCAGCTGTGGGATCTTGCGCTCGCCAAGCCGGTGCAAGAATTTA
ATCTGCCTCACGGCAAGGAGTCGGATGCAGTATGCAGCGTCATGTATCATCCCCCCACGGGTATGATCGTGGTTGGACAC
CCGACCAGAAACTCGGTATACTTCCTTCACCTGTCGGCGCCCAAGTACGCAATGAGGAGCTTGTCGCAGGTTGATTACAT
CCAGCGGCTCACGGCCCACGACACGACAATTCCGCAGCCGGAGTCGACGGCTGTCATCAGCGGGTTGCGCGAGTACTCGC
TGACCAGCCGGGGATTGCTGCGCAGTCTGGATATTCTCCAGAACCCGGCTTCCAACACGGAGGGAGACGACCCGACGCTG
TTTGAGCTGTATGCCATGCATTCCAAGGGTGTCAGCTGCATCTTTATTCGGCAGGGCGAGCTTGGGTGGACGAAGGACAA
CAAGGTCATGAACCCGGTGGATGCTGTGGAGTCTGGCAAAGTTAAGATCGGAAGACTCAAGTCGCCACAGCAGCCGATGC
TTTCCGCCGAAACCAACGGGACAGATGCAACGGCCACGGCGCCGGCCTCGGCCACGACCACGCCGGCGCCCCAGCCAGTG
CCGCGGGTGATTGCGTCGCGTGCCAACGCTAAACAGCTGCTGCAAAACAACAGCCCGACGCCGCAAGCACAAGATGCGGG
TCGCAAGCAGGCCGATGCCACTGCACTAGCGTTGGACCTGAAGACTGCTGAAGCCAAGGAAGAGGACGCGAATGTAGGAG
GCACTAGCTCTGCGCACAAAACCGAAAAGAAGCCCCGGAAGAAGAAGTCGCCGGCGACGGGCGCAACGGGACCATCTTTG
GCCGTTGCTGCTTCGGCAGACCGCGATGCCCTTGCCGGGAGCAGCAGCCTGTCCCACGGGCAGGCGCCGGCGAAGACATC
AGAGGCAACGAGGGGCGCTCCTCCGTCGCCAGCTCCGACGGTTGGCAATGGGGCGATCGACTTGCGCATCAATGCGATGG
AGGCGCGGATCTGCGACCTGGTGTCTAGCTCGGTACACACGGGATACGAAGACATTAAGAAGAATGTCAATCAACAGTTC
CGGTCCCGGGATGCTGATTTCGAGCAGAAGCAGCGGAAGCTGCTGGAGCTAGTGTCGGATGTGCTGAACAAGAACACGGA
GCAAGTTCTGAGCAAGATCGTGCGGGAGGAGTTTGACAAGCGGGTGGTTCCATCTCTGCGGGACAATGTGGTGCAGTCGA
TCACGGAGAACCTGGGCGGCAAGATCAACAACCAGGTTTCGACCGTGCTGCAGAGGGAGCTGCAAAAGTCCCTTCCAGCC
CATGTGTCCAGCAGTCTCCGCAGCCAGGAGGTGTCCAAGGCTATCAGCGACAAAGTTGTGGTGGCGGTTTCGCGCGAGGT
GGATGAGCAGATCAACCGGGTGGTGTCGAACCAGGTCATTCCGGCGATCTCGAACGTGTCCGCGCAGGCTGTGCGGGATG
TGGCCCACAACCTGCACCAGAGGGTGTCTGAGCGGTTTGCCGAGCTGGAGCAGCTGCAGCTGGTGCAGGAGAGCAAGATG
GACTCGCTGACATCGCTGTTGACTCGGCTGTCGGAGACCATCTCAACGATGGCGACGGCACAGACGCAGTACCAGAGCCA
GCTGCTGAAGATGCAAGAGCGGTTCCAGAACCAGGCAGTACAGGTCGAAACGCAGGCACAGGCAAGCCAGGCTCAAGCTC
AGGCTCAGGCTCAGGCTCAGGCTCAGGCCCAGCAGGCACAAGCACAGGCACAAGCCCAGGCGCAAGCTCAGGCCCAGGCT
CAAGCTCGGGCTCAAGCTCAAGCCCAGGCCCAGGCTCAGATGCAGCAACAGCACCCGCAGTCGTTCCCACAGCCGTTTCC
GGCTCACCCGTCGCAGCAGCAGTACCACGGCCATGGCCCGCAGCTGCAGCACCGAGGTTTCGACAGCGGAGCCAGCAGCC
TTTACCACAGCCCGACGGGTCGGGTAGTCAGCCAGATCGCGGCATCAGGCACGTCTCCGTCGCAGCACTCCAGCTCGAGC
CAACCACATCCGAAGGTGCCGCAGTCGCAACAGTCGCAACAGTCACAACAGTCGCAACAGGGGCAACAGTCGCAGCCCCG
TGTGCTGTACGCACCGAAGTCGCAGGAAGAGCGCGAGCGAGCCGAGCTCGAGCAGGTGGCAGCGGTTATCGAGGACCTGC
TGAACGCTGGCAAGTACGATGACGCGATGATGCGCTGGCTGCAGAGCAACGACAAGGAGGAGAAGCTGTTCCGCATGGTG
CTCGTACACCAGCCGCCCGACATTATCAACAACTTGCAGCCGCTGCTGCTCCTATCGGTGGGCACGACGGTGACGCAGGA
TCTGGAGGGGCCGCTGTTGCCGGAAAAGCTTTCGTGGGTCGAGTTGGTGGTTCTGAATCTTTACCAGGTTGCGAACCAGC
TGGTAAGTTCTCTTCGTTTCTATTACTACTCCATCTGCTTGCAGCTAATGCTAACAATGCGCAGGACGACCAGACGCGCG
AGATCACGCCGACGGTGCTGGCACACATCCGGGCTCGCCTGGAGTCCATTCTCGGCAGGCTTCCTCTCGGCGACCAGAAC
GCAAAGAACGTGGGGCAGATGATTACGATCATCAACCGGATCATGGACGTGGCTCAATCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62