GenePrediction:GLEAN_2123 Details

Name: GLEAN_2123
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:902737..904134 (+ strand)
Length: 1398
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:902737..903170 (+ strand)
Length: 434
Type: CDS
Source: GLEAN
Position: GCSC_108:903270..904134 (+ strand)
Length: 865
>GLEAN_2123 class=GenePrediction position=GCSC_108:902737..904134 (+ strand)
ATGGCTTCCGCTCTTCTCTGCGCTGCCGTCTGGGCCGTGGCCGTGCCGGTGTCGGTGCAGGCGGCCGTGGCGCTGCAGCA
GGCTCGCGCGACCGTCACGGCCGAGCTGGCGGCCGATGGCATCAGCCCGGTGCCGACGCCCGGCCCTGACCTCCGGGCAC
TGCTGCGACGGCAGCACAGCGCGGCCACGACGGTGTACTTTGCCGAAGACAACACGTGCGGCTTCCTGACCGGCCGCGAG
GACAACGCGTACACGTGCAACGACCAGCTGGCGCAGTGCGCCATCATCACGGTCAGCCAGCTGGGCCTGATCGGCTGCTG
CGACGGCCACGACTGCGGCGGCTTCCACCTCGACTGCGTCGACTTTGACTCGTACTGGAGCTCCGACGACGGCTGCGACA
GCAGCTGCCAGACGGACATGCTGACGCTGAAATGGTGGGTTGGGGATGTCTTTCTATTTTTCTTTCTTTTTTTCTTTCTT
CTTTCTTTCTTCTCTTCTTTCCTCTCCCTCTCTCCTCCCCGTTAACTCTTCAGCTCCGACGTCGACACCCCGTACTGCAA
CACGGCCAGCATCAACGGCGGCACCACCCTCCAGGTCTACGGCTACTTCTGCGATGCCCAAGACATCTCCACCGTCCAGC
CCATCATGACGACCTATGCCGGTGAGGCCGACGACCGCTCCTTCTCGCCCTCTGTCCTGTCCGACGTCTCGTCGACGGAC
CCGTCAGACGACCCGTCCCCGAGCACCTCCACGACGCCCCATCCCTCGTCCAGTCCTTCGTCCAGTCCTGCACCCGCGAC
CAAGTCGGCCAAGAAGTCCAATGTGGGTGCCATTGCTGGAGGCACCGTCGGCGGCGTCGCCGCCCTAGCCTTGCTGGGCC
TGGCCATCGCCTTGATCATGCGCAGCCGACGAAAGGACGTCCAGATGCAGACGCAAATGATGCAGCCACCACCACTACAG
CCCCAGATGCAGCAGCAGCTGCCACCACAGCCGCCACCACCTGGCCCTTCCCCGTCTATGCAGAAGATGCCCGAGTATGC
GGTCACGCCCCAGCAGCCCCAGTATCCCGGCTCGCCCGGCCTGCCGGCCTATAGCCAGCCAAACTATGCCCAGCCAATCT
ACACCGCCGCCGGACAGGTGCCGCCTGTTCGCACCGGCTCAGCCAGTCCGCTGTCGCCCGACTACAACCGCATGAGCAGC
ATCAGCGGCATGTCCACGGGCACGTCGGCCGTCGGCCCCATCAGCCCGCAGACGACCGGCCACACCATGGCCACGGTGGT
GCCCAACGGAGGCGCTGGCGCGGGAGCAGGCGTGCCGCCGACGATCCATGAGGCGGGCGGCGATACGGTCGGCGCGACCA
GCGATAATCACCATGGCCAGATGCATGAGCTGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62