GenePrediction:GLEAN_2125 Details

Name: GLEAN_2125
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:920381..921713 (+ strand)
Length: 1333
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:920381..920514 (+ strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_108:920613..921253 (+ strand)
Length: 641
Type: CDS
Source: GLEAN
Position: GCSC_108:921328..921713 (+ strand)
Length: 386
>GLEAN_2125 class=GenePrediction position=GCSC_108:920381..921713 (+ strand)
ATGTCGGACGTTGAGGATGCGATGGAAGTTGATCCGCAGCCGCGGACCGACGTCACGTTTTCAGCCGCAAGCTCCAAGGG
CAAGCGAAGCACGGCAGCGAACCTGCCGGTCGAGGCCGAGGATTCGCTCCCATGGTAAGTGAGTAGGTGCTGTTGGGGAT
GGGAGTCGTGCAGCACCCAAGGAAGACGGCAGCAGACAAAATGGCTGACGGGCGGGTGCTTCCGGGCGACAGGGTGGAAA
AGTACCGGCCGGTCTCGCTGGACGACGTGTCGGGCCACCAGGACATCCTGGCGACGATCAACAAGTTTGTGGACTCGAAC
CGGCTGCCGCACCTGCTGCTGTACGGGCCGCCGGGCACAGGCAAGACATCGACAATCCTGGCGCTGGCGCGGCGCATCTA
CGGGGCGGAGAACACGCGGCAGATGGTGCTGGAGCTCAACGCGTCGGACGATCGCGGCATCGATGTGGTGCGTGAGCAGA
TCAAGACGTTTGCGTCGACGCGGCAGATCTTTGCTGCCAGCAGCGGCCCGGCGCCGTCGCTGGCGCGCTACAAGCTGATC
GTGCTGGACGAGGCCGACGCCATGACCAACACGGCGCAGATGGCGCTGCGCCGCATCATGGAAAAATACACGGCCAACAC
GCGCTTTTGCATCATCGCCAACTATGCCCACAAGCTGTCGCCCGCGCTGCTCTCGCGCTGCACGCGCTTCCGCTTCAGTC
CGCTCAAGGAGGCCGATATCCGCGTGCTCGTCAACAAGGTCATCGCCGACGAGGACGTCAAGATCATGTCGGAGGCCGCT
GACGCCCTCGTCACCCTGAGCCGTGGCGACATGCGGCGCGCTCTCAACGTGCTGCAGGCCTGCCACGCATCGAGTGAGTG
GCCACCAGGCGTGTGGCATAAGGTGGACGTCCAAGAACACAGCTGACTGGCCATTTCTGGCTCCTAGGCACCCCCCTTCT
CCCAAAAGACGCCCCCAAGACGGACATTGTCCGCGAGCTGATCACGACCGAAACCATCTACAACTGCATTGCTGCACCGC
CGCCCGATGCCATCCGCGAGATCCTGCACACCCTGCTAGAGACTAGCGACGTCACGTCGTGCCTCGACACGGTCAATGCC
CTCAAGGTGGCCCGCGGTCTCGCCCTGGCCGACATCATCACCGCCCTCGCCGAGGAGATCACAAAGGTCGAGGCTAGCCC
CAAAGTCATGGTCACGTGGCTGAGCGGCCTGGCCGAGATCGAGCACCGCGTGGCTGGCGGTGCCGGCGAGACCGTCCAGA
CGGGTGCGCTCGTCGGAGTCATCCGTAGCGGCTGCGAGCTGATGGGCCAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62