GenePrediction:GLEAN_2126 Details

Name: GLEAN_2126
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:925332..926942 (+ strand)
Length: 1611
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:925332..926942 (+ strand)
Length: 1611
>GLEAN_2126 class=GenePrediction position=GCSC_108:925332..926942 (+ strand)
ATGAAGGTCGAGACGATGGCGATGATGGCCGCGCTGGCAACGTCCGCTCTGGGCAGCTCGCCGGTGACGGACTACAACGT
GTACTCGCGGTACTGGGGTCAGCTATCGCCGTATGCGTCCAACGCGGACGACCTGTTCGGGGTCAACGACGTGGGCGTGC
CGGCCGGCTGCGGACTGGAGCAGGCACACCTGCTGCAGCGCCACGCGCAGCGTTTCGGCACGGGCGAGTTTGACGATGCG
CCCAACGACGCGACCTTTGGCGACCGCGTGGCATCATGGCAGGCGCGCCGGGCCAAGAGCACGCGCAACAGCAGCTGCTC
GGCCTTTTCCGGTCCGCTCGCCTTCCTCAACCAGTACTCGTACACGCTGTCGGAGAGCGTGCTGACCGGCATCGGGGCCA
CGACCGAGTTCAGCAACGGCGTCGCCTTCTGGAACCGCTACGGCCGTCTGCTCTACGGCGCCGTGCCCGGCCAGGTGGCC
TACAACGGCAGCTTCACCAACGGCACGGCCAGGCCGAAGCCGGTCCTTCGCACCACCAGCCAGAGCCGGATCCGGAACTC
GCAGATCAGCTGGTCGCTCGGCTTCTTCGGTCCCAGTTTCAGCGCCACGCCCAACCCGATGCTCGACGGCTGGACCGACG
CCTTTGACGTCGTCGTCATCACCGAGGGCGGCACCGAGAACAACACGCTCGCCGCCTACGACAGCTGCCACGACGACACC
ATCGAGCCGGTCATCGACATCGGCGACCAGGACCTCTGGGGCTACCTGTCCATCTACCTGGCCGCTGCCACCAAACGGCT
GCAGCCCTTTGCGCCCGCTGGCTTTGTTCTCACCGTCAACGACACGTACGCCATGCAGAGCATCTGCGCCTATGAGACCG
CCTACATTGGCGAGTCGCCCTTCTGCAACCTCTTCACGCTCGACGAGTGGGCCGGCTTCGAGAACACGCTCGACATCGAG
TACTACTACGACTACACCTACGGGAACCCGACTGGCCGTGCTCAGGGCATTGGCTACCTCCAGGAACTCCTCGCCCGTCT
GACCAACCAGCTGATCTACTCGAGCAACTCGAGCATCAACGCCTCTCTGACCAACAACGAGCACGACTTCCCCCTCGGCC
GTCCTTTTTACGCCGACTTCAGCCACGACGACATTATCGTGTCCGTCCTGACTGCCATGTCGCTCGATTACTTCCGCGAC
CCGCCCTCGCTGTCCCAGTGGCCGCCCAACCCCAACCGTGCCTTTGTGCTCTCGCATCTGACACCCTTTGGCGCCCATCT
GGTCACCGAGGTCTACGGCTGCGCTGATGCTGATCCCACCGCCGTCACTGCCCACCAGACCCTTTACAAGCTCTCGGACA
CGGGCTACAACGCCTCGGCCGCCCCCCACAAATTCGTCCGCATGCGCCTCAACGAGGGCATCCTGCCGCTGAACACCGTT
CGCGGAGGTGCCTGCTACGGCCGCACCGACGGCCTTTGTGCTCTCGACTCCTTCCTCGAGAGTCAGGCCAACGCCACCGC
CATGGCCAACTACCAGTACGCCTGCTTCGGCAACTGGACCCTGGCCGATCCGTTCAGCGGCGCCGACTACGATGGTACCA
TCTTTGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62