GenePrediction:GLEAN_212 Details

Name: GLEAN_212
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:266975..268284 (+ strand)
Length: 1310
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:266975..267003 (+ strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_167:267525..268284 (+ strand)
Length: 760
>GLEAN_212 class=GenePrediction position=GCSC_167:266975..268284 (+ strand)
ATGTCTCCTCGTGGTGCTAGCATATCTGGGTGGGTGCTTAAGGGTCCCGCATTGTCAGAATAGCAAAGTCCCGGCACCGG
TCTCAATTTTTGCTAAAGTCTCGCTGGGCTGGCGCACTACGTACAACCATGTCGATATTTTCATCACGAGTGAGTTGAAA
ATCCTTCTATGGAGTGAAGCAGGCCCCTTTCTTTGTTGACAAGGTTACAGCTGGCGCGTTTATTTTTCTGGCATGGTACA
TGCCACATCTTCATGGATCCATGATACTTTTAGAGCCGTGGCTGGCTCTCCCGTTCGTTGCCGTGATTTCTGCCGTTATC
GGTCATTTCGTTTCACTACCACGGTTTTCGGGGCCGGTCCGCTTCGGTTACCACGAACACTTTCGAATCTACCGGAGTCT
CTTTGATTTCTAAATATGCATTGTGCTCGTTACCGCGGTATCCCCCGTGTCTCTGTCATTTCTTGGCATCGGGCTCAGCG
TCGCCTTGTCTCTTGCTGCATGGACCTATGTTTACCGTGCATATTGCGAGAACCTACGTGACGTATCCAGTCAAGCCGCC
ATTGCGGTGTCGCGCGCAAAGCTTGCTGCTGCCACCACTCGCGATTACGCTGCAGAGGCTCGCCGGCACGAGGAGCGGAT
GCTCGATGTGGCAGCCACAACAAAACGGGATGCCGTGATGGTCAAGGCCGTCCGAATCACCGATTTCTTTGACTGTGCCG
CAAATGCCTGGGCGGCTATGGGGAATGTCACGCAACTCACTCAAGACACTATCAAGAAGGCCGACGAACTGGTTGAAGCC
GCTCGTGTTGCCAGTGATGCGGACAAGCCAGATGCCAATCCCGATGGATCTGATGATGGCCAGGATAGTTATCAAGAAGA
GCTTGCCGAGAGGCTGAAAGAATTCGCAGATAGGACAATGCGCGAGGCTTGTGCGGTTCAGGAACAGCTTCATGTCGCCC
AAGGAGCTGTGCATATCTCCAAAAAAGCCATAGAGCAGGATACAGCAGCGCGGGAGGCCGTTGAGAGCAATGCCAAAACG
GCCATGGAGGCGACCAAGCTTCTTAGCGAACGGATCAAGACCGTCTTGCGAGGAGCGGAGCTTGAAGTGGCAAACGGAGT
GGCCAGGGTGACGTTGTTCTCGGAACAAGCAGTGACTGCAGCCATAAAAGGCGAGACGACTCGGGCAAAGGATTTGGTTG
AGTCTTCCAAGACGGAAGCTACGAGCATTGAATCTCAATTGGATCGTGTCATTGCGACTAGGGATTTGGGGCTGGACGGA
ATTCTGGCATTTCTCGGGGGTAGCCTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62