GenePrediction:GLEAN_2130 Details

Name: GLEAN_2130
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:947572..948982 (+ strand)
Length: 1411
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:947572..947902 (+ strand)
Length: 331
Type: CDS
Source: GLEAN
Position: GCSC_108:947977..948070 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_108:948127..948184 (+ strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_108:948246..948651 (+ strand)
Length: 406
Type: CDS
Source: GLEAN
Position: GCSC_108:948706..948778 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_108:948844..948982 (+ strand)
Length: 139
>GLEAN_2130 class=GenePrediction position=GCSC_108:947572..948982 (+ strand)
ATGGCTACAGAGGAAACGACAAGCAGCACGGCCAATGGTCGACGGTATGAACATCTTTCGAGTCCTGACCCGGTCTGGTT
GCAGGTCGCAGAGAAACACCAGGTTCTCGAGCCGCTGGCGGACAAGCTGTACAGTCTTCCGATCGAAGAGTTTCGCAAGG
TGCCGTACAAACCACCACCGCTACCAGCAAACGCTCCTGTGATTGGGAAGGACGTCGCGGTCGAGCAGGCCGAGATCACG
GTGCGAGACGGTGCAAAGATTGCGGCGCGAATATGTCGCCCGATCGAGCGCAAGGACGGCTCAGTACTGTTCTTTAACAT
ACACGGAGGAGGTGAGCACTGGGAACGGCGAATCGGCCGAGATGTGGTTGCCACCAACTAGTATGCCTGACGTCTGGAAA
ACTAGGATGGACTGTCGGAACGCCTGAGACTGAGGAGGCCGTAAGCCGTCAGGTGGCCGTCCAGAACAAGGCTGTTGTTG
TCAGCATTGATTACAGAAGGTAGCAGTGCCGGACTCGACTGTTGTATGCGCAGCAGATCCTCTAACACATCGTAGAGCAC
CAGAGTATCCATTTCCGTATGCTCTGAATGATTCAAAGGACGCACTTCTGTGGGTAAGTATTCAGGAGAGCTTGCCGGGC
TTCCTTTCCGTTTTGGATACTGACCGTACTGCAGTGCAAGGACCATGCAAAGTCTCTCGGAATAGATCCAGAGAGATTAA
TCATTGGAGGCGGCAGCGCCGGTGCAAACATTGCAAGTCCTATATTACCATTGTATCCTGTCACCAAACCTAGAACTAAC
ATTGCAACCGTGACTCAGGCTGCTGCACTTTCCCACATAGCACGAGATGAAGGTATTGGTGGCATAATTGGACAGGTCCT
GAACATACCTGTTACTTGCCATCCGGACCATTTCCCCACATCAAAGTACGAGTATCACTCCTTTGAGCAGAACGCAGGCT
CGCCAATTGTGAACGCCTTCAGAATGAGAAAGTTTTGGGGCTTCTATCTTCCCACGGCAGACGCCAACCCGCTGGCCAGT
CCGCTTCTGTCCAAGTCATTCACGGGGTTGCCCCCAGCACGTACGTCAAGCCTTGTATTCTATTCTGCCATTATCTGCAA
CTAACATTTTGCAGTCGTACAAGTTGCTGGAATGGACCCTCTCAGAGACGAAGGGCTGGCGTACGCGGAGGAGCTGAAAG
CAAACGGGTGAGTTGGAAGCTATTGTATTCACGGTTGCAAGATGAGTTCTAACTGGTGTTTAACTACGGCAGAGTGGACG
TGGTGCTCAATGTCTACAAAGGGCTACCACATGCATTTTACATCTATCCTGACTTGCCACCGTCTGCGCGGTATACGCAG
TCTGTGGTGGACTGGATTGAACAGCTGTTGGCGAAGACGGGTGGGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62