GenePrediction:GLEAN_2132 Details

Name: GLEAN_2132
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:954736..955700 (+ strand)
Length: 965
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:954736..954829 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_108:954974..955019 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_108:955139..955700 (+ strand)
Length: 562
>GLEAN_2132 class=GenePrediction position=GCSC_108:954736..955700 (+ strand)
ATGGACGGGGAACTGGCTCTCTGTCCTATAGCCAAGAACGCAAGGCGCGTTTTAGACATGGGCACGGGGACTGGACTATG
GGCTATTGACTATGGTATGTATTACTTTGGCTCGCTGTGCCGCCGTGTTATCGACATTTGTACTTACGTATTGGCTGTTT
TAGCGGACTTACATCCAGAAACTGAGGTTTGAGAACCTTGCCTAATTCTCGATTGCCGAACCTTGTTCTCACATTTAGCT
TTTCAGGTTATTGGTGTAGACCTAAGCCCCATTCAGCCACCATTGTATGTCCGGCCTATGTCCTTGCGTGCCTCAACCTG
GTGGCCTTGATTCGTTCACGCCGACAGGCTTCGTGAGCGGAAGGTATTAGAAAGATATCACTGACGTGGCATACTCCTTA
TAGCGTCCCCCCTAACGTCAGCTTTGAGATCGATGACCTAGAAAAGGAATGGACGTGGACGAAGAAATTCGACTTTATCT
TCTCCCGTATGATGCTTGGCTGCTTTGAGAATCTCCCGGCAATCATAAAGGTGGCGTTCGATAACCTGGAGCCAGGAGGT
TATCTAGAGCTTCAGGATATGGCCCTCCCAGCACGCTCCGACGACAATACACTACATCCGGATAGCTACCTCTCCAATTG
GTGCAATTACTGCTTTAATGCAGGAGAGGCACTTGGACGTCCTGTTTTCCCTGTGACTGAGTACAAAACCTACTTAGCTG
CTGCTGGATTCGAAGACATTGTTGAGACACAGAAGAAGTGGCCAATCAACACTTGGCCTCGAGACAAAGAGTATAAGGAG
CTTGGCGCTTGGGCGTATGCCAACATTGCCGAAGGACTTGAGGGCCTGTCACTTGCCTACTTCACGCGAGGCCTTCACTG
GTCATCCGAACAGACATTGGTATTTTGCGCGGAAACAAGAAAGGACCTGAAGGATACAAAAATACACGCCTACTGGCCGA
TGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62