GenePrediction:GLEAN_2133 Details

Name: GLEAN_2133
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:957350..957698 (+ strand)
Length: 349
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:957350..957510 (+ strand)
Length: 161
Type: CDS
Source: GLEAN
Position: GCSC_108:957545..957698 (+ strand)
Length: 154
>GLEAN_2133 class=GenePrediction position=GCSC_108:957350..957698 (+ strand)
ATGAAGGCCACGCCGCGCCGCGCTCGTTTCTCTACCGGCCTTGGCTCAACAGTAGACAGCCTTTTCACCGAGTACTCGGC
TGCGAACCCAATCAGTGATACACCCTTTGTAGCCCCAGAGACGGCTGCTGAGCGAGATCGGGTATGGTCGGCTTGGACGG
AGTATGTAGCTTACCTTTGCTTTCTCATTACGCAGCACTGTGCTAAATACAGTGCTCAGGTTCTGCCGTTACCGCTCCGA
CGTGGACCCTTTGCAGTACTGGGTAGATTTTGTTGGCGACCCAGCCAGTCCTGTGCTTCAGACTCCAGCTCAAGTATTCC
TACACGTATATGTTACAGAGTCTCATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62