GenePrediction:GLEAN_2134 Details

Name: GLEAN_2134
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:991260..991889 (+ strand)
Length: 630
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:991260..991664 (+ strand)
Length: 405
Type: CDS
Source: GLEAN
Position: GCSC_108:991764..991889 (+ strand)
Length: 126
>GLEAN_2134 class=GenePrediction position=GCSC_108:991260..991889 (+ strand)
ATGTCTTCCAACAACGAAAATTTCGTTAGGAGATACCCGATCCGGGACAGGAAACGCACGGAATTCTACACTGACCGCAC
CAGCGAGCAGGGGAGGAGAGCCACCAACGACCGCGGAGCCCTGCGCAAAACCAGAGTCACTAATGGCCGCAGAGCCCTGA
ACCGAGACAGAGCCCTGAGCCAAGCCAGTCCGCACATTGCGGACGAGACAGCGAGCACCTGGACCCGGGTCCTGCGGCTC
TCGCTGCTACTCTTCTTCGACATCCTTACCCTCGTCTTCATCATCGGCGGCTTCTTCTTGGTGCTCTGTGTGCTCTTTGA
GAACTCGGCCTTCGCACCCGCACATACAAACACAAGCGTACTCGAATCTGCTGGTCTGGTAGCGCCCACAGCATTCATCG
AATCCGTTTGTCTGGTAGCGCCTACAGAATCCATCAAATCCGTTGGTCGGATAGTGCCTAGGAAATTAATGTCGCCGTAC
GTTATTCTCGGACTGCCCTGACAGGATTATCCTGGCGGCAACGCACATATTACCGACAAAGACATCCGGGCGGCGTACCG
AAGGACCCTGCTGCACTTCCACCCGGACAAGATTAAGGCTGGGACTAGCGAGCAGCTGCTAGAGGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62