GenePrediction:GLEAN_2135 Details

Name: GLEAN_2135
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1004184..1006580 (+ strand)
Length: 2397
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1004184..1004731 (+ strand)
Length: 548
Type: CDS
Source: GLEAN
Position: GCSC_108:1004825..1006580 (+ strand)
Length: 1756
>GLEAN_2135 class=GenePrediction position=GCSC_108:1004184..1006580 (+ strand)
ATGCAGGCCTGCGACCGATGCCATGCCCGCAAGACCCGGTGCGACCGCCGGTTTCCGCAGTGCGGTGCCTGCGAAAAAGC
CAGGGTCTCGTGCGTGCACGCGGACAAGCTGCGACAGCGCAACATCCCACGCGGCTATCTCGACAGCATGGAGGCCACAG
TGCGACAGCTGCAAGAGGAGAACCGGGTGCTGCGACAGAGCCTGACGGCATCGCAGGCGAAAGCACAGGGACAGGGACAG
GCACCACAGCCGGTACCGTCCTCGCCTTTGGGCACGCTGTCCAGCCACGAGGAGGATCGGCAGCACCGGCAGAACGACGG
CCACCCGGACCAGACACCGCTGCCGGAAGGGCCCATCAGCCCGCCGCCATCGTCGGTCGAGAGCGGCAGCCCACCGGAGA
ACGAGTTTGCGGTCGAGGTCGGCTACCTGTCGCTCATCGCCACGGGCGAGACCCGCTATCTCGGCTCGAGCAGCGGTCTG
GGCCTGGCCAACATCATCGGCCACATGGTGACGTCGCAGGCTAGCATGGACTCCGACGGTGAGTCGGCGTGTGTGCCGCT
GGCTGCGTCATCGTTGTCGTCGTCGTCGTCGTCGTCGTCGTCGTCGTCGTCGTCGTCCTCGCACACGGTCGTTCCGGCCA
GTCCCTCTCCCCTTCCACCGCTCCACACCGTCCGGCCCTTCATCGAGGCCTACTTCCAGCACACACACATCACCTTTCCG
CTGCTGCACCGGCCCAGCTTCCTCGCCACGGTCGACCGGATCTACGGCGAGCCGGGCTTCTATGAGCGCCATCCGCGCGA
GGCGTTCGTCTTTGACATGGTCCTGGCCATCGGCAGCTCCAACTTTAATCGGTTCGACGAGTCGGCCGCGAACTCGTGCC
GTTTCTTCGCCGTCGCCCAGTCCAAGCTGGGCGCCATGCTCTCGATGGACGACAGCCTGACCGCCCTCAAGGCTATCCTG
CTCATCTCGCAGCACGGCATCTTTAGCAATCTGCGTGACACCAGCGCCAGCATCTGGCACCTCGTTGGCGTCGGCGCCCG
CATCTGCATCGAGCAGGGCCTCCATTTGGAACGACGTCAGCTACAGCAGCAGCAGCAGCAGCAGCAGCAAAACGGCAGCG
CCCATACACGCGCCGTCACCCTCGACGAGGAGCTGCGCCGCCGCTGCTTCTGGTCGCTCTACAATCTCGACCGCGTCGTC
AGCTTCACGCTCGGCCGTCCGGTGGCCATCCGCGACGACGAGATCGACGTGCCGCTGCCCTCGCCTCTCGACGACGCCTG
CTTCTCACCCGACTCATCCTCGTCCACCGATACTGCTGCACATTCACCCCTCCACCCTTCTGCCGTCTCGCCCTTCCTCC
ATCTCATTCGCATCCGTCGTATCTCCGGCCAGATCCTCACCCAGTTCTACAACTCCCGACATCATTCCAACATCTCCATG
GAAGATCGCAGACGCATCCGCCGTCGCTTCCATGCCGACATCGACGCCTGGCGAGACGATACCAAACACCTCCTCGACGT
TGCATCTTCCTCAACCTCCTCCACGTCTTCCTCTACCCCCCCGTCTTCCAATACTACACCCACCTACAAATCCAGCTTCC
TCTCTCTCGACTGGTACAATGCCGTCTACAGCAACGCCATCCTGCTGCTGTACCGTCCCTCGCCAGCCCTTCCACACCCG
ACCATGACGCTCGCGCCCGACGACGGCCGGCCCGAGCTGATCGAGCTGCTCAATGCCTCCCGCTCCTCCATCGAGTCCTA
CAGCCGGTTGCACCAGAAGCGCCGACTCAACTACTCTTGGATCACCCTGCACGGCGTCTTTATAGCTGGCCTCTCGTACA
TCTACGCCCTCGGCCGCCTACTGCGCGATCCTGCCACCTTTGCGCTCGTGCCCGAGCTCTTCTCCATAGTCGAGGTCACC
CGCTCGTGCTCCAACGTTCTCGTCGCCATCTGCGAGCGCTGGAACGCCTCCCGCCGCTCTTGCGATCTGTTCAACAAGCT
GAGCAACGCCGTCATACAGGATGCCCTCAACGCCTCGTCCAGACAGGCGAGGGAAAAGGACCGTGACCGCTACGGCAGCA
GCTGCAGTCGCCAGTCTGATCCGCTGGCTCGTGGTCACGTGCACAAACCGCAAGCTGCCACTACGCCCTACAACAATACT
GCCTCCACGGCCTCCCTCGACGCCGTCCTCGACAGCCAGATGCAGCTCGACGAGAACTTTGTCATGGATGAGTTCCGCCA
GTTCATGGGCTCCCTCGGGGCCGGCCATCCTGGCGATGCCATGCCCAGTGAAGTCATCGCTGGTTTCCTGCAGGATTGGC
CCTTTGACAATCCCATTGTCAGCTCAGAGGGCGAGAATGAGTCAAGTATGCTTTCATGGGATCTGAGCGGTAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62