GenePrediction:GLEAN_2136 Details

Name: GLEAN_2136
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1010511..1012296 (+ strand)
Length: 1786
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1010511..1010540 (+ strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_108:1010601..1011018 (+ strand)
Length: 418
Type: CDS
Source: GLEAN
Position: GCSC_108:1011225..1011641 (+ strand)
Length: 417
Type: CDS
Source: GLEAN
Position: GCSC_108:1011701..1011827 (+ strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_108:1011892..1011973 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_108:1012177..1012296 (+ strand)
Length: 120
>GLEAN_2136 class=GenePrediction position=GCSC_108:1010511..1012296 (+ strand)
ATGAAGGAATACAGCGTCTATAACATTGCGGTGAGTCACGTCTTGGACGCCCTCTGAGACACATCCGGGACACCACGCTC
ATAAAGGCAGGTGGTATGCTTTGCGGCGTTTGGGTCCCTCTTCACGGGAAACTCGTTCGCCGTGTTTGCGTTTACGATCG
GCCAGCCGACGTTTTACACCTCGCTCGACCTCGAGAGTGACAGCTCAGCGCCCGGGTACAGCTACACAAACGACATCACC
GGGGCCGCTAACGGGGTCTTCTTCGGCAGTGGTTTCTTTGGCTGCTTCCTTGCCGGCTGGGCGGCCATCCGGTTTGGACG
GGTGAACGGCTTCCGCATCGCAGCAACGACGGGGATGATTGGGGGCGCGCTCCAGTGCGGGTCGCAGTCGCCAGCCATGT
TTCTGGTTGCCAGAGCGGTGGCCGGACTGGCTGCAGGCCACACGATGGCGGCGATGCCGACGTACTTTGCCGAAGTCTCT
CCGCCTCAGTCCCGCGGACTGATCACCGGTGCACACGCCATCTTTATCAACATCGGCTAATGCACGGCCGGGTGGATTGG
GTACGGATGCTACTTCACGCCCGGATCCACGTTTGCCTGGCGGTTCCCCTTTGCCATGGTCGTTGTCTGGGGTTTCTGTC
TCCTGGCCGGATCGTTTTACGGTAAGCCGTTCTGCCATGCACGAAACGGGAATGCCGTTCTGATCAGCGTTCAGTGCCGG
AAAGCCCCCGGTTTCTGGTCCAGCGCGACGACCACCAAAAGGCGCTGGAAGTGTTGCTCCGCCTGCACCACAGCGCCAGC
GACCCGGACAACAGCTTTGCGCACCAGGAGCTGCAGATGATCGTAGACCGGTGCCGGGCCGAGAAGGAGGTCGTCCGCAC
AGACGGGCGATGGCGACTGTTTACCAACAAGGCCAACCGTAAGCGGCTCGTGCTCGCCTGGCTGGTGATGGTGGGCGGCC
AGAACATTGGGCCGCTGGTGATCAACAATTACAACGTGCGGCTGTACGGGTCGCTCGGTCTGGGCGCGACCACGTCGCTG
CTCCTGTCGGCTGTCTACAACACGGTCGGCCTGATCATGGCCTGCTTTGGCGGCCTGATTGCGAACCGCCTTGGTCGGCG
GAAGGCTCTGGGTAAGCAAGACGAAGAATTCCCGTGTGCTTGTGCGCGTGTTGCTAACGTGAGGGCGAAGTGACGGGCTA
TCTGCTGGTGACATGTGCGTTTGCCGTCTTGACTGGGATGATTGGAAAGTACAACACTACACCGACCAAAGGATGGGCTG
CTGCTGCCACGACAATGGTCTACATCTACGTGACATGGTGAGTGTCATTTTCATGAGTTCGAGCTGCGGTGTCGCTGATC
TGCTGACACATGGTATCACAGCTACAACTGCTTTGTCGATCTAATCCAGTTCACCCTTGCCACGGAGATCTTTCCGACCC
ATATCCAAAGCCAGGCATCAGCGGTAGCAATCAGTAGTCTGTTTCTCGCAGACATTCTCTAGCTGAATCTGCTGCCGACC
GCGACAGCATCGATAGGGTGGAAGTACTATTTGGTGTTTGTGTGTCTGGCCGTCGTGCATAGTATTTACCTGATCTTCAA
GCTTCCCGAGGTATGTGTACTATTTCAAGTCTCTACTCATTGTGAGCCTATTCTGACACTGTGCAGACCGGTGGTTGGTC
TCTGGAAGAGATGGATCGGGCGATCGACGGCGACGTCAAATCAGACGAGAATGAGAAGAACGAATGGGAGCCAACACATG
TCGAGGGGGGTGAAAAGAGCGGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62