GenePrediction:GLEAN_2137 Details

Name: GLEAN_2137
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1013826..1015376 (+ strand)
Length: 1551
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1013826..1014237 (+ strand)
Length: 412
Type: CDS
Source: GLEAN
Position: GCSC_108:1014328..1014671 (+ strand)
Length: 344
Type: CDS
Source: GLEAN
Position: GCSC_108:1014780..1015376 (+ strand)
Length: 597
>GLEAN_2137 class=GenePrediction position=GCSC_108:1013826..1015376 (+ strand)
ATGGCTGCCCTGGACCCGAAAAGCTTCAACAAGCTGTACTTGAACGGCCAGTATGTCGCTGCACAGAACAAGGAGACGTA
CAGCCTCAAGAATCCCAAGGACAACAGCGCCGTGACGGACTGTGTGCCGATTGCCGGGGCTGCAGATGTTGATGCCGCAG
TGGAATACGCCGAGGCGGCATTCCGCGGGCCATGGAGCAAATTTACCGGCATTCAGCGGACCGAGTGCTTTATGCGTCTG
GTCGCACTGCTGGACGAAGAGCTGACGCCCATCCTGACACTGGACTCGCAGACGTCGGGCATTCCCGTTTCGCTGGCGCC
CGTGCGCGAGCGCAATTACATCCGCAACTGTCTGATCTACTATGCCGGCTGGACAGACAAGCACAAGGGGGACTACTACC
CGGCAGACGATGGTAGGTGAGATGCGATGAGACGAGCGTAGAGAGGAAAGGAGACGTGAGAAATACGAGCGAGCGGTACA
GACCATAATGCTGACTAAGCAGGCTTTGTCAAGCTGGTGCGCCACGAGCCGCTGGGTGTATGTGCGGCCATCAATCCGTT
CAACGCGCCGCTGGCGACACTGTTTCTCAAGGTAGCGCCGGCACTGGCGACGGGCAACGTGATCATCGTGAAGCCAAGCG
AGAAGACGCCGCTGGGGACGCTGGCCGCGGCCGCGCTCTTTGCCCGGGCTGGCTTCCCGCCGGGGGTGGTGCAGGTCGTG
ACGGGGTTCGGGGCGACGGGCGCGCTGCTGGCGGAGCACATGCGGATCCGCAAGGTTAGCTTCACCGGCTCGGTGGCAAC
GGGCAAGCGGATCCAGGTGGCAGCAGCCCAGAGCAACCTGAAGCGAGTGACGCTGGAGCTGGGCGGCAAGAGTCCGGCGG
TCGTGTTTGCCGACGCAGACATGGAGAACGCGCTGACCTGGACGCTCAACGGGATCCTGGCACGCAGCGGCCAGCTGTGC
GTGGCGGCTTCGCGCCTGTACGTGGAGAAGAGCGCGGCGCCGCGATTCATCGAGGCCTACACCGCACGCATGAAGGCGGC
CGCTGGTGATCTGGGCGATCCCCAGGACCCCGACGTCCGGCTCGGCCCCATGGTCGACGCTGATCAGCTCGAGCGCGTGC
GTGCCATGGTCGAGCGTGGACGTGCCGAGGCTGAGCTCGTCGTCGGCGGCCTGCAGCACGGCACCACTGGCTGCTTCATG
CAGCCGACTGTATTTCTCAATCCGCGCGACGACGCGGAGATCTACCGCAACGAGATATTTGGGCCCGTCGCCATCATCAA
GACGTTCGAGTCCGAAGACGAGGTCCTTCGGCTCGCCAACGACACCGAGTTCGGCCTCATGGCCGGCGTCTTCACCCGCG
ACATCACCCGCGCCCTTCGCCTCTCGTCCGCCATCGAGGCCGGCGTCGTCGGCATCAACTGCGTCAGCCTCCAGAGCCTG
CAGGCCCCCTTTGGCGGCAAGAAGCAGAGCGGCGTTGGCCGCGAGTTTGGCGAGTACGCCCTCCGCCTCTACACCGAGCC
CAAGACCGTGCTCATCAACATGGCCGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62