GenePrediction:GLEAN_2138 Details

Name: GLEAN_2138
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1019440..1022258 (+ strand)
Length: 2819
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1019440..1019509 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_108:1019546..1019695 (+ strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_108:1019971..1021808 (+ strand)
Length: 1838
Type: CDS
Source: GLEAN
Position: GCSC_108:1021905..1022258 (+ strand)
Length: 354
>GLEAN_2138 class=GenePrediction position=GCSC_108:1019440..1022258 (+ strand)
ATGTCCGGGCTGCTCTACATTACAGGGCCACCGACTGCAAACGACCGCCTGCTGCTCGCTGTGATCCTTGGTAGCTGAAC
TCCGATCGCTACCTCTCTACCATTAGTTGGCCACTTGCACCTCACTTCAGCCGCACCGTTGCCCATAGTCGTCAGCGATA
CCGGTGTCATGTCGAACTACTCGGCCAGCGAGATCGATACCAGCTCGATCCAGTCGCCGCGCTCCATCATCACCCTCGTT
GTCTTTGTGCTGACCAGTAAGTGTTACGGTGACGTCTCCGCACTTCTGGTACATTGTGTACTTTACACCACCGCCTACAT
CTGCTTGTATCCTTCCTGAGCTTATCATCACTTGACTCGATACGGTCGTCTCATCTTCACCTCATCTTCACCTCAACCTC
TCAGCATTTAGATTACCTCTGTTTCACTTCCTCTCACTACATCTCACCAGCAATCACCTCTTATCCAAGACAGCCTAATG
CTCTCATCTGCCTCAGCCTTAACATACCTGCTACTAGTCACTGACCAATAGACTGTGCCGTCTTGTTCCCCTTCCATGTC
CCCTTCCTTCTCCCACTATGGGTCTGCAACGCCATCCTCCGTGTCCTTGTCGCTTTGCGCATTATTTCACCGCCCAGACA
TCGGCTGCAGAAGCGCTGGCAGTGCTTCAAGTTCCCCGTCAACTTTGTCACCGCGCCGCTGATCGCCGACCTCTTCCTGC
TCGCCATCCTCGCCATCGGTCGCGATGAGGTCTATGGCGGCACCATCGGCTCCAACAACATATTCCCCATCGATATCATG
GCATTTTTTCTCACCCTCGCCTACGTCGCCATCTCCATTGACGCCTCCGGCCTCGTCCGCTACCTCGCCTTCAAGGTTCT
CCAAAAGGGCGGCAAGGTCGGCCACCGCCTCTTCTTCTACCTCTACGTCTTCTTCTTCGGCCTCGGCAGCTTCATCGGCA
ACGATCCCATCATCCTCTCCGGCACCGCCTTCCTCGCCTACATGACCCGCGTCTCCTCCAACATCGTCCACCCGCGCGCC
TGGATCCACAGCCAATTCGCCGTCGCCAACATCGCCTCCGCCATTCTGGTCTCGTCCAATCCAACCAATCTCGTGCTCGC
CGGCGCCTTCCACCTGCGCTTCATCGACTACACCGCCAACATGATTGTTCCTGTCCTGGTCACCGGCATCGTACTGTTCC
CCTTTCTTCTGTACATTGTCTTCGCCGACGAGTCGCTCATCCCGCTGTCCATCACCATGTACGAGCTCGACGAGGACGCC
CGGTCCAAGAAGCCGGTCAACCCCAACATTCCCAACGCCCGCGGAACCGCCAAAGACACCGAGACCCAACAGGCCAACGG
CACTCCCAGCAAGCAGCTGTCGCTCGAGGAGATCATGAACCCCTTCCTCGACAAGGGCGGTGCCACCTTTGGCGCCATCA
TCATGGCAGCCACCCTCATCACTCTGCTCGTGCTCAACGCCACCAGCCAGAAAACGGGCGAGCATCCCGTCTTTTACGTC
ACCCTGCCTGCCGCTTTTGTCATGTTCTGCTGGGACCTCAGCTTCGGCTGGATCCACCGCAAGGAGACCCGTGAACTCGC
CGCCAAGGGCCGCGCTGAAATCGCCGCTGCAGAGGAGGCCGCCCGCGAGGCTGAGCTGGCCAAGTTAACTTGGAACAAAC
TGGCCGAGCAAGGCTTGCTCGACGAAGCCACGCATACCGTAAACCCAGAAACAGAAGCCTCAGGGCCACGCACGCTTGGC
TCCCAAAACACTCCCGGCGCTGACTCGACTCTTTCGACATCGCCAACACGCCCGCTTCAGTCCATCAGCGGCGCGCTGAA
AGCTGTCGGAATCTACGTTACGAACGAGGACACCGCCGATACGCTGACAAAAGGCATTTGTCTGTCAAATAGCGTGCGTG
GAAAAGGAAAGGGTGCGGTTGTTAGCCATGGAAAGGACGCGGACGGTAAGACTGTCGCTGGCAATGGTCACGTGATGACC
ATGGGCCATGAGGTCACCGACATCGATGCCGAGAAGCTCTCGAGCCCCATTCTAAGCGGCATGGACACCGAGAGACAAGA
CACGAGTCTAGACAGGAGCAGTCCAGGTCAAGCGCCGGCCACACTTGTCTCACTCTGTAAGAAGGCATACGTCTGGTCCC
AGGAGACCTTTCCGACCGTGACAACTGTGCTGGCGCACCTGCCCTTTGCGCTTGTGCCATTTGCCCTCTCCATGTTTGTG
CTCGTGCAGGCACTCGTAAACAAGGGCTGGGTCGCCGTGTTCGCTTATGGCTGGTATCACTGGGTCGACAAGACGGGTAC
TGTCGGCAGTGTGGGTGGCATGGGCTTCTTGTCCGTCATCTTGTGTAATGTGAGTACTGTTTGGTTACTCGTTGTGTTTT
ATCTTCTTTTCTTCCCCGGTGCTCAGTCTATACACGCCGTTTACCCGTCCTAATCCGATATCCAGTTCGCCGGCACCAAC
ATCGGCACAAGCATCCTGCTCTCCCGCGTCATCCAAGCTTGGGTAGAAATCCACAAGAGCAAAAACCTGCCCATCAGTGA
CCGCACCTTCTGGGCTGCCGTCTACAGCATGGCCCTGGGTGTCAACTACGGCGCCTTTAGCGCCGCCTTCAGCGCCTCCC
TCGCAGGCCTTTTGTGGCGCGACATCCTCGCGCGCAAGCACATCCGCGTGCCCAGCCTCGAGTTCGCACGTGTCAACCTG
CCGATCATCACCATCTCCATGATCGTCGGATGCACCGTGCTCATCGCAGAGATCTATATAATGCGAAACGACAAGCCTAT
AAACTTCTCAAAACTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62