GenePrediction:GLEAN_213 Details

Name: GLEAN_213
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:272139..274619 (+ strand)
Length: 2481
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:272139..274121 (+ strand)
Length: 1983
Type: CDS
Source: GLEAN
Position: GCSC_167:274190..274430 (+ strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_167:274561..274619 (+ strand)
Length: 59
>GLEAN_213 class=GenePrediction position=GCSC_167:272139..274619 (+ strand)
ATGACGACACAGCAGCAGCTCTCTAACGCAAAGCCGCTTGAATATCTAAAAGGACTAAACGGCGAAGAGGCTAGAGCCTT
ACTCGACACCATCGACAGTCTGCGTGAGCTGGAAATTGACAAAATCGAGTCGCTTCCTCAAATCATCGTGGTGGGTGACC
AATCGACAGGCAAGAGCTCTGTTCTCGAGGCCATATCTCGCGTCCGGTTTCCCGTCGACGCAAAGCTATGCACTCGCTTT
GCGACAGAGCTGGTTCTGCGTCGAGCAGATGAGACCAGAGTGACAGTCAGCATCCGCGTGGCCGAAAACAACGGCAAAAA
GGATGGCAGAAGTCACGGTGAGCCGTTTACGCGGACCAACTACGATGTGGCCTCGCTGCCGCGCATCATCGATGAGGCCA
AGGCGCACATGGGCGTCATCGGTGCGCACGCGTATGGGGGCCAAGGGAAGAAGCGGTTCTCGAAAGATGTCCTGCGTATC
GAGATCTCACGGCCTGACGTGTACCCACTCACGCTCGTCGATCTCCCCGGAATCTTTCGCAATGTGACAGCCGAACAGAC
TGCGGAGGACATAGAGACTGTCAAACAGCTCACAAACGAGTACATGGCCCAGAAACGAAGCATCATTCTGGCCGTTGTAA
TGGCAACCAACCAGCTCGCAAACCAGGACGTCATGATGATGGCAAAGATGCACGACCCGGAGAGAAAGCGCACCGTGGGT
GTGATCACCAAGCCGGACTTGCTGAGCGAAGAGGGGGTCACGCAGCAGTTTGTGGACGTCATCAAGGGACGCGATCTGAC
AAACAAGCTCGGTCTCGGCTGGTTCGTCCTGCGTAACCTGTCCGAGAAGCAGAAACAGGACCAGCCAGACGTTTCGTTTG
ATAAGAGAGATGCCATGGAGCAGCAGTTCTTCCGGACAGGGGACTGGAGCTCTGTCCAGCAGGCACATCGAGGAGCCCAG
AGCCTGCGCAAGACGCTTAGCAAGGTTCTTCTCGAGCACATCAAGGCCAGCCTGCCCGAGCTGATCCAGAAGATCGAGGA
GAAGCTGCACCAGCGAAAGGAAGCGCTGCGATGTCTGGGGAGGCCGAGAGTCGATCTAGACGAGCTGCGGCTGTACCTGC
ACGACGTTGCCAAGGAATTCCACCGCCTGGCCAGCGACGGTGTCAACGGACGTTATGCCGACGCCTTTTTTGACGGACAA
GAGGACGATGCGGGCGGGCCGCGCAAGCTGCGCGCGAACCTGCGGAAGCTGAACAGCGTCTTTTATAGCGTCCTTAAGGA
GAAGGGTGCTGCCAGGAAGATTGTTTCCGGTGAGTTTATATTTTGGGGCACGGACGCTGCAGACAAAACGGCTATACCCC
CGTACCTGCAAGCCCTCACGGCACAGTACAGCCACTTCCCGCATCCTACCGCCGTCTCTCAAGAACAGTTTAACCGCGAG
ATTGAGGTGTTTGCTGCCGACAACCAGGGCCAGGAGCTCCCAGGCGTCCCCAGCAGCGATCTCGCCATCAGTCTCTTCCG
ACAGCAGGCCAAACCCTGGAGGGAGATTGCGCGCTTCCATCTCGACCTCGTCCTCAAGTTTGCCCAATCATTTGTCGAAG
ACGTCTTTGCGCACGTTATAGGAGATGACAAGCACACCCAGGCGGCCTTTTTGAATAGGTACTCGGACCCGTTCTTTGAC
AGAAAGAGGGAGATCCTCGAGGCGAAGCTGGACGAGATTTTGCGTCCCTACGTTCAGGGCAACGGACTGCCGATGGAGAC
TGAGTTCCGTACGTCCCTGAACGCAGCCACAATGCTCCGCCTTGGGAAAAGGGTGGTCTCCGTCCTGGAAACTGAACATC
CCGAGGTCTTTTCGAAAACTAAGGACTCGGGAGACCGGCTCACACCGGCTCAGCTCTCGCTTTCCATTCGCACTGCCGCG
ATTCTGCCGGACAGTAAATTTGGTGCCGACAATGTTGTCGATATGATGACAACCTACTATGATGTGAGCTCGGGCTTCTT
TTCTCCTCTCCTCGAAACACTATGCGCGTACTCACAGTCTCTGTCGGACAGATGTCCCACAGAACGTTTACCGAGAATGT
GATCAATCTTGTCGTGGAAAACTGTCTCGTGTCTGACATTCCAGAAGTCCTGACGGCCGGCATCGTCTTTAAGATGAGCG
ATGGTAGAGTGCACGAGCTGGCCGCGGAGTCAGACGAAGCCATGGCCGATCGGGCCCAGCTACAGGCCGAGGCCCGGATT
CTCGAGCAAGGGCTCTCTAGATGCCGAGTGTACAAGCCTCGAACCGTGACAGGTGTGTTCTGGCATTCCACATTCCCCTC
AACGTGTCTTGCAAATCCGGCATTTATTCTTGACTCACCGTACACTTTCACGTAGTGCTTCCATCGACCCCTTCTGCTAC
AAAATCTGTCCCTTCTTCCAAGACATGGCTTTCACCTTCACCAAACGTGAACAATACGTACAACAAGGCCAGTTCAACTA
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62