GenePrediction:GLEAN_2141 Details

Name: GLEAN_2141
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1030359..1032964 (+ strand)
Length: 2606
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1030359..1030932 (+ strand)
Length: 574
Type: CDS
Source: GLEAN
Position: GCSC_108:1031029..1031399 (+ strand)
Length: 371
Type: CDS
Source: GLEAN
Position: GCSC_108:1031468..1032964 (+ strand)
Length: 1497
>GLEAN_2141 class=GenePrediction position=GCSC_108:1030359..1032964 (+ strand)
ATGGGTGGCAAGAGCGACTTCAAGGTCGTGATTGGCGGCGGCAGCATCTCGGGCCTGACGCTGGCCAACATGCTGCAGAT
GCACGACATTGACTTTGTCCTGCTGGAGGCGTACCCGAACATTGCGCCGCAGGTGGGAGCGAGCATCGGCATCCTGCCGC
ACGGCAACCGGATAATGGACCAGTTGGGGCTGTACGGCAACATCACGGCGCTCTGCCCGCCGCTGGACTCGTTTCACTTC
CGCGACAAGACCGGGCACATCATCAGCGAGTTTTACGGCATGAACCACTCCATGTGCGAGCGGCACGGCTACTCAATTAA
CTTTCTCGACCGCCAGCAGGTCCTGCAGGTGCTCTACGACAACATCAAGGACAAGACCAAGGTGCTCACGAACAAGCGGG
TCAAGAACGTGGACGTCAGCGACGACGGTGTCTCCGTCCGGACCGAGGATGGCTCAACGTACCACGGCGACATGTTGATC
GGCGCCGACGGCATTCACAGCACCGTCCGGTCGGAAATGTGGCGGATCGCCGATGCGCAGCTGCCGGGATGGATTCCGTC
TGACGAGAAAACATGTGAGGTTTTGTTTCTTTTCTTTTTGTTTCGCTTTTTTTTCCTTTTTTTTTCTCGTTCCTTTTCTC
TCTTGAATCCTCCCTCCTAACAGCCCCTAGCCGTGCCCGTCGACACACTCTGCATCTTTGGCATCTCCAAGCCCTGCGAA
GGCATCGACCCGGGGGCTTCCAACTCGGTCTTCCGGAAACACCAGTCTTACATCGTCAACGGTGGTCCCGAAGGCCGGGT
CTACTGGTTCTACTTTGAAAAGCTGCCCAAGTGCGTCTACGGCAACGGCATCCCGACGTACACGAAAGAGGACGAGATTA
GGCTGCTGGCGATGCACGAAAACGACCCGATCACGCCGACGCTCCGGTTCAAAACGCTGCTGGACCGCCGCATTACGTCT
GTCATGGTGCCGCTGCAGGAATACATCTTCCGCAAGTGGTACTACAAGCGAATCTTTACGCTTGGCGATTCTGCCCACAA
GGTTCGTTTTGTCTCACTCTCTTCTCTTTCATTCTCTTCTTTCTCCCATCACTAACTCGCCTCGAACAGTTCAACCCGAT
CTCGGGCCACGGTGGCAACGCGTGCATCGAGTCGGCGGCGACACTGGTCAACAACCTGCTGCCGGTGCTAGACGCGGCCA
GACGCCGGGGACGGAAGCCGACAGTGGGCGAGCTCGGTCATGTATTTTCACAGACGCAGACGATCCGGCAGGACCGGGCA
CGGCTGCTGAAAGAGCACTCGCACGACCAGCAGCGGATGGAGGCACTAGACTCGCCGCTGCACGAGCTGGCGGCCTTTTA
CCTCGTCCCCCTGATGGACAATGAGGATATCACGTTCAAGTTCTCCGGCAACATGCCGCTGGCCGAGAAGCTGCACACGG
TGCCGATCCGACCAGTGCCACGGCTGGTGCCCTACAAGGACGAGCTGCTGAGCACGCCACAGCCTCGGGGCGCGGCCACC
AAGTGGACGCTCATCGCCTTTTACCTGGCGATTGCCGGCCTGGTGCACTACGGCATGTGGACACGGTCGGCCTCGTACGG
GCTGGACCGACATCTGGGCGCGATCTTGACGACGGGCCACTTTGTGCCGGACCCGGACTTTGTGCTGAAGCGGACGTACG
TCGGCATCCGGGCGATCGACGACTATCTGGTCTTTTTGGCGGCCATCTTCATCACGGGCGTCAACGGGTGGGACCGCACG
TTTGGCATGCTGCAGCTCTACTTTCTCGGCATGCTGGTGCAGCCGATCGCGATCTACACGGTCGAGGCTTTCCGGCGCCG
CAACAAGGTGACGCCACTGGCGCTGATGACCGTCTGGATGACGCTGGTGCAGGCGGCCGGCGTGGGCATCTACATGCCCA
TCTACTACGCCATCTACACGTTCGTGTCCGAGCCGGAGCCATACTGGTGGCCGTTCAGCCGCGAGGTCAAGGTCCAGCAC
GCCCGCTCGCTCATGGCCGCCCTCCTGCTCGGCTACGTCCTGCCGACCGTGCTCATGTTCGTCCCCTGGGGCTCGCCCGA
GACCGTCCAGAACTTCGAGGCCCTCTGGCAGGTCGGTCCCATGCTCGTGCCGCTGCTCACCAGCCTCTTCGGCTGGTGGT
ACGCCCGCACCCACAACCTCAAGGCCGTCGCGCCCACGGCCCGCCAGGTCTTCCCCGACTTCAACGCTCTGCAGCAGGTC
TACGTTGTCAGCGGCGTGCTCGGTGTGCTGCTGCACATCTACTGCCTCGTCCGCATCAGCTCATCGCCCGACCTCTCCTT
TACGGCCGTCTTCTGGCCCGACCTCTCCGCTCAGCCCAAGGAGCTCGGCGAGGGCCTCACCGCCCTGTTCCTGACCGACT
TCTGGGGCTTCGTCGTCGCCTCGTGGGCCTGGCTCATCATGGCTGTCTGGGACGTCCGCCGGATGGGCCGCTCGACTGTC
GACGTCACCAAAGCCGCCGTGCTCATCACCCTCGGCCACGTCTTTGTCGGCCCAGGCGCCACCATGTCGGCTGTCTGGTA
CTGGCGAGAAGCAGCCATGGCCAAGACCACCTTTGCCGATATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62