GenePrediction:GLEAN_2142 Details

Name: GLEAN_2142
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1033713..1035627 (+ strand)
Length: 1915
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1033713..1034650 (+ strand)
Length: 938
Type: CDS
Source: GLEAN
Position: GCSC_108:1034709..1034850 (+ strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_108:1034899..1035627 (+ strand)
Length: 729
>GLEAN_2142 class=GenePrediction position=GCSC_108:1033713..1035627 (+ strand)
ATGAAGGCGCCGTCAAGTTCAAGTCTTCTGGTGGCTCTCAGCCTCTCGGGCCTAGCGGCTGGAGCTGTGCATAAGACATT
AGCTGCTACTCCTCAGGGTTGGAAAGCAAATGCGGCAGTAGCCAGCGATCAGGGTCAGGACCAGACTGCCATCTTCACCC
TGGCTCTGCACCGAGACTTTTCTGATCTGGAAAACCACGTACTCGGCGTATCGACCCCGGGGCACGCAAACTATGGAAAG
TATCTAGATGTCGGCGATGTTGAATCTCTCTTCTCGCCGGCAAGCGGTGCCGCTTCCGCTGTGACGGCTTGGCTCGAACA
GAACGGCATCTCCGACTACCAGATTGATGGGAGCTTTGTCGACTTTACTGCGACTCTGGAGACGGCGAACTCGGTCCTCA
ATGCATCATACCAGCACTACACCAGCACGGATCAAGACACGACGACAAAACTCCGCACCTCGCACTACACGATCCCAGAC
GAGGTTGAGAACTACATCGCCTTTGTTGACCCAGGCACCTTCTTCGGCAGCACACAGAAGTTTAGGGTTCCGTCGCACCT
AAAAAACCCGAGCCGCCCGACACCAGCCAAGCGCGCAGCGTCTTCCACTGTCGTTGATGCATCCTGCGCGACATCCATCA
CCCCCTCGTGCCTCAAGCAGCTATACAATGTCCAGGATTACCAACCGGACGCGAACTCTGGAAGCCACATTGGTTTCGGC
AGCTTCCTGAACGAGTCTGCACTTTACGCTGATTTGGAGCAATTCGAGGAGCTGTTTGGCATTCCCAGCCAAAATGTTAC
CAAAGTCCTGGTTGCCAACGGGATCAACGACCAGAATTCCTCCAACGGAAACTACGGGGAGGCGAATCTCGATGTGCAAA
CCATTGTCGGAGTCGCACACCCCTTGCCTGTGACGGAATTCATCACAGGCGGTTCGCCGTTCGTGTGCCCCTCCTACGCT
CGAGCTTCGATTCGTTTGTACTGACACCCAAAACAGCCCATTTATCCCCACGTATGGACAGCCCACAGCAGCAAATAACA
GCAATGAGCCCTACGTGCCCTTTTTGCGATATCTCCTCTCCAAAACAAACGCGGAGCTGCCACAGGTCATTTCTATGTCG
TATGGCGACCAAGAAGACGTGAGTATGCAGGCCTGCAGTAACTGAAAGTCAGCTGACATTTTCCAGGGTGTCCCCTACGA
CTATGCCGTCTACTCGTGCAGTCTGATCGGCCTTTTGGGACTCAGAGGAATATCTGTGCTGTCATCCTCAGGCGACGGTG
GTCTTGGCGGAGCTTGTCTGGGGACCGATTTTAAGACGGTTGAATTCGGGCGAGTCTTCCCAGCATCCTGCCCGTTCATC
ACCGCAGTCGGCGGCACGTCGGCATCGTCTGTCCCCGAGGTGGCTTGGGACCAGAGTAGCGGCGGCTTCAGCGGCTACTT
CCCACGGGCTTGGTACCAAGAGAATGCGGTACAGGGGTACCTGCAAAACCGCATCAGCCGCGAGACATACGAGTACTATG
GGCAGTACACCCATTTCGGTGGTCGGGCATACCCGGATGTTGCGGCACACAGCTTGAACCCGGACTTTGAGATCATCAAC
GCTGGTAAGCAATCCGCCAGTGGTGGCACGAGTGCGGCGTCGCCTACGTTTGCGGCTATCGTCGGCTTGTTGAACGATGC
TCGCTTCCGTGCGGGAAAGCCGTCTCTGGGGTTCCTGAATCCTCTCATCTACGCACTGAACGGTCGCGGATTTTTCGATG
TCGTGGACGGCTATACGTATGGCTGTTTAGGCAAAAAAGCAGGCGAGGGAGTGGTTCCCGGTGCCCGATGGAATGCTACG
GCTGGTTGGGATCCAATAACAGGATTTGGCACACCTGACTTCCAGACACTGAAGGGGTATGTGCTCAACCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62