GenePrediction:GLEAN_2144 Details

Name: GLEAN_2144
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1043474..1045230 (+ strand)
Length: 1757
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1043474..1044782 (+ strand)
Length: 1309
Type: CDS
Source: GLEAN
Position: GCSC_108:1044908..1045230 (+ strand)
Length: 323
>GLEAN_2144 class=GenePrediction position=GCSC_108:1043474..1045230 (+ strand)
ATGGCCTCCACCAACGGACTGGGCGCAACCAAGGAGCTCGATGTGCTCATCATCGGCGCCGGTTTTGGCGGCTGCTACGG
GCTTTACCGGCTGCGCCAGCAGGGATACAAGGTGCACGTGTTCGAGGCTGGCAAAGGCCTGGGCGGCGTCTGGCACTGGA
ACACGTATCCAGGCGCGCGCGTCGACTCGGAGATTCCCTACTACCAGTTCTCCATGCCGGAGGTATGGCGCAAATGGACG
TGGACCGAGCGGTTCCCGAGCGGCGACGAGCTGCGGGCGTACTTCCGGCACGTCGACCAGACTCTGGGCCTGTCCAAGGA
CATCAGCTACGGGGCCAATGTCGTGGGCGCCACCTTTGACGACGAGTCTGGTCGCTGGACAGTCACGACCGAGGCCGGCC
AGACGGCTGTGTGCAAATACCTCATCTGCGCGACCGGCAGCTCGTTCCGGCCGCACATCCCCGACTTCAAGAACCTCGAC
CGCTTCCGCGGCCAGCTCATCCACTCGACGCGCTATCCGGCCGTGGCCAACACAAAGAACGCGCGCGTTGCCATCGTCGG
CTCGGGAGCCACGGCCGTCCAGTGCACCCAGGAGATCACCAAAGAGGCTGCCCAGCTGACCGTCTTCATCCGCACGGCCA
GCATCTCGCTGCCCATGGTGCAGCGGCCCTTTACCGAGCTCGAGGAGCGCATCGGCAAGAGCACGCTGCGCCGGACCTTT
GCCTACTGTCGTAGCACTACCTCCGGCCTCGGCTACGACCGCCAGCTGGGCTCCGTCTTTGACCTCAGCGACGAGGAGCG
CGAGGACTTTTGGGAAGACCTCTGGAGCCGCGGCGGCTTCAACTTCAATCAGGCCAACTACCGCGACTTCCTCGTCGACC
CCCGTGCCAGCCGGATGATGTACGACTTCTGGGCCAAGAAGACGCGGCCTCGCGTCCGAAACCCGGAAAAGGCCGCCTTC
CTCGTGCCAGAGGAGCCCCCGTTTGCCTTTGGGACCAAGCGGAGCAGCCTCGAGCAGGACTACTACGAACGCATCGACCA
GGACAACGTCGACGTCGTCAACCTCAAGGCGACCCCGATCCGCGAGTTCACCGAAACCGGCATCATCACCACCGACGGCC
GTGAGCGCCCGTTCGACATCGTCATCCTGGCCACCGGCTTCGACGCCATGACCGGCAGCCTCACCAATATGAACATCCGC
GGCCGCGACGGCCTGACCTTTCAGCAGCGCTGGAAGGATGGCGTCTTCACCCATCTCGGTCTCTGCAGCAGCGGCTGTCC
GAACCTTTTTATGATATATGGACCTCAGGGTGGGTTTTGAGCTTCTTTCTTCTTTCTTCTTTTCTTTTTCTTTTGTTTTC
TTTTTGTTTTCTCTTTCTTTTCTTTTTCTTCGTTTTCTTCTCCTTCTATCTCTTCCATCAAACTAACTCTCCAGCCCCCA
CCGCCTTCACAAACGGCCCCGTGTTCATCGAGAGCCAAGTCGACGTCGTCATCGACCTGCTTAATAAGCTCCAGAGCGAA
GGCATCAAGTCGATCGAGGCCCAGCGGCCCGCTGAAGAAAAGTGGAAGCAGGCCATCCAAGACGCTAACGACAAGACCCT
GTTGCCACTCACAGACTCGTGGTACATGGGCGCCAACATCCCAGGCAAGAAGCGGGAACAGCTCAACTACCTTGGCGGCA
TTGCCAACTACGAGAAGGAGTGCCGAGAGGCCATTGCCGGTCTGGACGGGTTCACAGTCGTGTACGATAAGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62