GenePrediction:GLEAN_2145 Details

Name: GLEAN_2145
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1058337..1059590 (+ strand)
Length: 1254
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1058337..1058765 (+ strand)
Length: 429
Type: CDS
Source: GLEAN
Position: GCSC_108:1058843..1058906 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_108:1058986..1059590 (+ strand)
Length: 605
>GLEAN_2145 class=GenePrediction position=GCSC_108:1058337..1059590 (+ strand)
ATGGCCTCGTCTTCTGTGGCCAAACCCTCTGTTTCTGCGAGGCTAGAAAGTCATGAAGCCGACGAGATGACGGACCTTGA
CAAACACGTCTTAGCCTTATTCAAGCAGTTAGTTGCCTCCGCTGAAAGACAGACGGAAGAAGATGCGCCCACACCTGGTC
TAGGGAGCTCAAAAGAAGCAGAACTTCAAGCAGATACTACAATCATTTTCAGCGCGTCGTCTGCCGTGAAAAATGCTGTT
GCCGAGATCCAGCAGTTGTGTCCAGCCCTCGACAAGAGCGACGAGCTGGAGGTGTACTTAACATCGTTGTGGGAGACGTT
CATCCTTGTAGCCAAATCCATACCAAGTGACAGCCCTCTTCAAGATGAGCTAGTAGCTGTTCTCCAGTGCTTGCGGTCGA
GAGCTAAGGCCACGATCGAGGTATGGGGGGTAAGAGCATACGCGGATTCTTCTGCCACTTTTCCCTATTCTCGTATAAAC
AACTAAAAACAGGTGTTTGTTTACAGGAACAAGCTCGCCTCTGGCGAGACTTGCCTTTGTTCTCGGCTATGGTGCGCGAA
GCTTGGTATGGTAAGAGCATGCTTTCATCTTTCAATTCTGTCTCTTATTTGGTGAAGTACAACTACTTCTAATAACCGAG
TACTTTCAGACCCTGATCCTATGGCGATGGAAAAAACTTCAATTGAAGAATACGCATCTATTCTTGTGGAATGGATCAAT
CTCAACGCTTTTTCCGCCCGAATTATGGAAAAGGGACTGCTTCAATGGACATTGTACGCTGTTATGGCAGTTGGAGCAGC
GCTGGAACGTTACCCCCCACCGTTGTCACCCATCATGGAGAGCGATATGGAGGGGGAGGACGAGACGGTCGAGGGGATCG
AGGAGAGCGAGCAGATCAAGGAAGAAGCGCGCATGTACTTTGAATGCCAGGTGAGCGTCGCTTGTCAATGGATCTTGCTC
AGCGGCTCTGAGATTTTCAGAGATGCCTTTCACCAAAAAACCCTTAACGAGACGGAGCTGGCATCGACAAATCCAGGTCC
TCTTTACAAGGAAGACGGCAGGGGGAAGCCGGGACTTAACATGGATCGATGGCGGTTTTGGCAGAAGCGTTTTGCGGAAA
TTGGGTCTGACGAAGCGAAACGGGCAGCCCAGCACATGGAGGATATTGTGAGGGAAGACGATCGGGTGATAGTACGCCGA
CTAGGGACCGCCGAAGAAGATGGTAAGAGCGGGGGAGTAGTAAAAGATACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62