GenePrediction:GLEAN_2147 Details

Name: GLEAN_2147
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1062387..1065059 (+ strand)
Length: 2673
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1062387..1064059 (+ strand)
Length: 1673
Type: CDS
Source: GLEAN
Position: GCSC_108:1064490..1064568 (+ strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_108:1064583..1064786 (+ strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_108:1064922..1065059 (+ strand)
Length: 138
>GLEAN_2147 class=GenePrediction position=GCSC_108:1062387..1065059 (+ strand)
ATGGCGTCGCGCAAGGAAACAAGGAGTGACGAGACAGAGTCGTCCGGTACTACCGAGGCTTCCCAGAGTACGAATGTAAC
GTCGCCAATGGCCAGAAATGAGGCAGACAACGAAAATATCCTTCCTCTTTTAACGCCACCCTCTGAGGAAGAAGCGGTTA
ACTACTATCACGGGATATTGTCGGAACCTCGGCTGGTAGGTCGTGCGTCTGCTGGCATCGAAATATGGGAGACTTGTAAG
CAAGTGATGGACCGTCTACCACCAGAACCATTCATGTACTACCCTCGGAAGCAGCTGGATTCGATCGGGAACCACCCTAT
ACGCAAGTGTTGGAGAGCTGTTCAGCCCCTGGTCGTCGAAGCAATCTCTGGGCTGCCATGGACGTCAATTGACATCTTTC
GGATCGGATATCAGGATTCCCAACCCGCCGAAAGGCCGGTGGTTGTCTGGGTAGGCGTTGAAACGGCAAGCATACCATGG
TACAAGGTGGCAGAGGCACTGCGGAGCTGCCGCAAAGCGCTGGACAGTGCAAACCTAAACCTGGCCAATGTGGACTGCCA
GATCCGTGTCTCGACTGTAATGTCCTTGGCAGGACCATCGCTGCTGCCGCCCTATAGAGAATCGCCCACGGATGAGACGG
TCTGTGTGACTGCGCAGCCATTCACAACTACTATAGGGCAATCCATCTTTCCTTTCTCAAATCCCGGATTACGAGGCACG
CTGGGCATCTATGTCAGTCCTGCAAGGACGACCAAGAGTCCAGTCTGGGCACTCACGTGTCGCCACGTCGGTATACCCAA
TGACACAAACCCGGACAACAAGCTGTACCATCGCAGAAACAGCAGTCAGAAAGCCCTGCGCATAGGTTTGCCAGCAGAGA
AGACAATGAACGAGTCCATGGTAGAGATCCAATATATGAAGGATGATTGGACTCGCAGGGCCAATAATGTTGACGACGCC
TTTACCCGACAGCAACTGGAGGTTGTTAACAGGCTTCATGGAACGATAAAATCGTTCGAGCCATTGGAGAATAGAGAATT
TGGCAGTTTGCTTTACTCGCCGCCTGTTGGGAGAGGCCAGTACACAGGAAATAGCGGGGACAGTCAGCCATGGACGCGAG
ACTGGAGTCTCGTAGACTTGGATGTCAAAAAATTCCCCGGCGACATCCCTCCAACAAACATGGTGGACCTTCGCACCAGA
GCGATGACCCGGAATGAGGTCAATCTTCTGCTCAATCCTCATGTTATGAACAAGCACAAATTCACCTTTCCAAACAACGG
GCTTCTTAAAATATCGGGAATCATCTCCCTCAAAGAGATGTTCAAACCGGTCACACGCGACGCAGAAGGAGAAAAGGGCT
TTCTCGTCGGAAAACGCGGTGCTGTAACGGGCCTGACTTGGGGAAAAGCATCGGAGCTGGAATCCACGGTGCGCAAGTGC
CTTCCTAGCGGAGGCTCGTTTGAGTCCTTTGAGTGGGCCATCCATGGATCGCTTGAAGACCACCACCGCGCCTTTAGTAA
GAAAGGTGACTCTGGTGCCGCTGTGTTTGGTATTGATGGACGACTCGGTGGGCTTCTTACTACGGGTACAGGAGAGGAAG
AGTCGCAAAAAATCGATATCAGCTACGTGACACCTATCGAGCCTCTGCTACTCGATATTGAGAAGGAAATGGGGTGCAAG
ATTACTGTCCTGTGATACTCAAAAGGAGTAAACAATTGAGAAGAATTAGAATAGGCTGTCTTCGTTCCACTTCGAAGATA
GCATAGTTGCGAATAATCCTTTTCTTCCGTTCGACATCTAGCTATTACAATATTTCTAGCTCGAACGAATGAAATCAAAT
TTTAGGTCAATAGATGTTGTAGAAGAAGCGTCAGCGACTCCAGAGCGGTGCACTGCCGCACTGAAGGATGCTGAGAAGCT
GTGTCAGACGCTGAGCTCAATCTGAACGGCATCTTTGAGATGGTATTCAAGCCCAACACTACGAACGATCTACGACAGCG
CCTACGCAACCACGCACACACTGGTGCCTATCCCAGAACGACCTTTTGCTGTGCGATTGGCCCCTTTTATGCGTCACTTT
AACGGATCTGGTTTTTCTGTCAGTCACGACAGCGGCATCATGGCAGAGATTGACGACAAGACGCTGCTGCACATTACCAT
CACCAACCTGTCTGTTCCCGTCGTGCAAACGGCCAGACGCCGCTGAACACGCTGACCTGCCCCACTACCGACTCCGAGAA
GGAGATGAAGGCGATGCTGGACATTGTCAGCGACCTTCTCGGCCAGGGCCACGCTGACCGGCGCCTTGGTGACAGCTCCA
AGAAGAAGCTCACACTGATCGACTACGCCGTCGCAGCAGGCTATCGTCGTCTCACAAACCTGCTCAAGGATCCGATCCCG
GTCCTGGATAAGGCTTCCGTTGGAGAGGCTGCGAAGGCTGAGAAGGCCAAAAATCGACAACGAATCCGAAGGCAGAGAAT
GCACATTTGAACAAAGCCCGTAAGGCTGAGACAGCTGAAGAAGTGGCAAAATCAGACAAAGCCACGAAGAGCTTCTACCA
AAGAGGCTGACAAGGCGAAAGCGCCCAGCAAAGGAAAGGCAACCGACAACGCCAAGGTTTCTGACGACGCCAAAGTGTCC
GACAAGAAGGTGCACAGGGGCACCAGAGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62