GenePrediction:GLEAN_2148 Details

Name: GLEAN_2148
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1070806..1073755 (+ strand)
Length: 2950
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1070806..1070816 (+ strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_108:1070886..1071308 (+ strand)
Length: 423
Type: CDS
Source: GLEAN
Position: GCSC_108:1071379..1072684 (+ strand)
Length: 1306
Type: CDS
Source: GLEAN
Position: GCSC_108:1072756..1072930 (+ strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_108:1073031..1073755 (+ strand)
Length: 725
>GLEAN_2148 class=GenePrediction position=GCSC_108:1070806..1073755 (+ strand)
ATGGAGAGAAAGTGAGTCTGTCCTCTCTGTTTTCCCTTTTCGTTTGCTGTCTTCCTGCTGACGCCTACGACGGCCTCCAG
TCCCATAGCCGCCTGCTGCCTCGCAGTCAGCAGCACCGTCGCCCGCACTGCACCCGCCCTCCACCGGTTCGTGCGCCTCG
TACGAGAGTCCCGCGCCGACGTCATCGCCCTGTCGGCCGAGCTGCACGCTCTTGGCGGCGTCTTGGAGCTGCTGGAGGAC
GATGGCGATGACGATGGTGGTGGCGATGCCGCCGGCTCGTTGTCGCTGCTGCCACCCGATATTGCGCTGCAGACGCCAGC
CGTCGTCGCGGCCTGCGGCCTCCTTGTGCACGCACTCGAGGAGCTCTTTGTCGACAACAGTCCGACCGACAATGCCGACA
GCCGGATACAGTGGACGGTTATGCGGAAGCAGGTAATTGAGCTGCGGCCCGGCCTGGAAGTGTACCGGCTCGCCCTGGGC
CTGGCTCTCGATCTCGTTGCCCTGTGAGTTTTTTTGTCTCGTTTCCGGTTTCGATCACGTTCTCTTCTCTTCCATCTGTC
TCTGACCGGCCAGAATTGCACCCGACACGACAGCCGACGCGGCCTCCCCACCACACGCCGAGATCGCACTTATCCTCGCC
GAGATCAGCCATTTGCGGCTGCGCGTCGGCAAGGCCTCCTGTGTCAACACCGACGCCGCCTTTGCGCTGCAAAACTACCT
CCACGTGCTGCAGCGCCACGCCTCGGCTGCCCTACATGGCCAGGGGCTGGACCAAGAAGCCGTCTACCCTCATGACGCCT
TTGTCGAGACTGCACCGACCGCATCGACCACACCGACTACGCAGCAGCCTGTCCGACGACGACCCACGGGCAGGAGCAGA
GACCGGCCCCGAATGGTAACCGGGACCATTGTCAGCACCGCGCCGTCGTCGAATAGTTCTTCTGCCCACAGCCCCGACAG
TGCGGTCGACTTGTGCTCCGAGCCGACACCACCGCTGCCCAAAGCCGCCCAGACTGCTGTCGCCCCCCCGGTTCAGAGGC
CAAAGCACCCCCGCCGAAGTCAGTTGCCGCCTGCCTGGCTGGACGTGGAGAACAGCCCGGATGAAGACGAAGATGAAGAC
GAGGCTCAGCCGCAATCGGCTATCGACCGCCTTCCCATTGCAAGCCCCCCCTCCAGCCCGATAGGGCCCATTGGCAACAT
TACTGCCACGACGACCACTACGACCACCACGACAACATCTTCGCTCTGCGTCAGCCTGCCAATTCTACAGCTCGACCAGC
TGCTCGACGATTTCCGGCGTCCGCCAACACCGCCACCACGGGCGGCCTCGAGGCCGCGTGGATCATCGCTGGTTGGCCAG
CAATCGCCGACGAGCGGACATACATACCAGCAGTACAACCCGTATCAGCATCAGCACCAGCACCAGCACAGCGTCAGCAG
CACCGGCACAGACGAGTCAGACGCGGCACCGCCGCCGATCTCGCGGCAACGACGCGGCAACATGTCGCTGCCGACGGTGG
CAGTGCACCGAGTGCGGCCCAGCACCAGCAGTGCTAGCAGCAGCATGTTTGGCGGGCATGGCGGCGGGTACGGCAACGGC
TTTAGCAGTGGCTTCAGCATAAGCAGCCCACAACGGACGACAAACGAAGTCAGCAGCGCGATCGACTCGGCACTGGGCAG
TCGGAACGGCGGCGGCAGCGGTGACGTTGGACTGGGCAGCAGTGGGTATGGCCACAGCCGTCTCAGAGCACAGTCGGTTT
CCCACAGCGTGGGTAGCAGCAGTCTGAGGACGCTCAGCACGATGAACACGATGAGCACGATGAGCACGATGGGTACCGGT
CTTGGGACTAGCACGATCGGGGACGGCAGCCAGAGCGGTGTCAGTGCGCGTGATGTTCGGGGTGGAAGCAATCGTCTGAG
CCGGCTCTTCTTCCGCAATCGATCCAACAGCGGGAGCGGGGGGGCAAGACCGAATCTAGCAGCGAGCCCGACGACGCCGA
CGATGCTAACGATTCCCGGAGTGGGGGCAGTCCGTCCTGGGAGCCGAGGCAGGCTGACACCGTCTTCAGCGGGCGGACGC
AGCGCCAGTCGACTGTCGTCATCGTTGCGGCTGATGGTGCCGTGGGTAGGGAACAACAACAAGCACGACAACGGAGAGGA
CGACGACGACGACGGGCCGGGAGAGGGAGCAGGGCCGGCCGGCACAGAGCCATGGTCGACAGCAGGCTTATCGGAAGCGG
TGTTTGGGGTGTCTCTGCGCAAGAGCATCCGGGTGGCGGGCACGACGGTACGGACACGACACGAGGGCAGCCAAGGAGCA
ACAGTGCGGCAGTTCCCGGTGTGCATGATGGTGTGCTACCGGTTTCTGGTCGAATCGGGCGGGGTGGCGACATTGGACGT
GTTTGGGGGCACGCAGAACAGCACGGAGGCGGTGCAGCGGCTGCGAGCGGCTTTCTCGCAGGGGCCGGACTACGGGGCGA
GCCTAGACCTGGCGGCTGCCGGATACAGCGCGCACGATGCGGCCGGGCTGATGCTGCACTATCTCGAGCGGCTGCGCCGG
CCGCTGGTGACGGAAGCGGTGGCGCGGCGATGGCTGGCGCTGTCACGCCAAGCAACGCATTCGCAGCCGGATGAGGGCAT
TGACTTCTGGGCTGAGGCGCTGGAGAGTGTCGGTGGTGGCAGCCGAGAGGCGACGCAGGCAGCGCGCAATCTGATGAAGC
TGCTGCTGAACCTCTGGGGCGACGTGGCGGACGCGGCGGACCGCAACGACATGACGGCCGAGCGGCTGGCTTCGTGCGTG
CTGCGGCCGCTCGTGCACGCTCGGCTGGCCGACAGTCGGGCCCGCACAGACTACATCCTGGCGCTCGCGTTTGTCATCCG
GCGACGGTCGGAATACGCGCAGCTGCTGCACCGGACCGGCCGCAAGAGCCATGCCGCGTTCGAGGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62