GenePrediction:GLEAN_2149 Details

Name: GLEAN_2149
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1080721..1081370 (+ strand)
Length: 650
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1080721..1080800 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_108:1080849..1080873 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_108:1081062..1081370 (+ strand)
Length: 309
>GLEAN_2149 class=GenePrediction position=GCSC_108:1080721..1081370 (+ strand)
ATGAAAATGCTCGCTCGCTTGCTGGCCTTTGGCTTCGTCGTGGCGCCCGTTCTCGGACAGGGCTACAGCTACGGCTCATT
GTAAGATTTTTTTTGCTTTATGAACTATCTGAAGACTGGCTTGATGAGCAATTATGGATCGACTGACAACCTGGTATAAA
TAAGAACATGGAGCCAGCAATATCCCACCACTATTACCAGCAGCAGCAGCACCAGTACCAGCACCGGCACCACCAGCACC
ACCACATCCTCGGCGACGACCACCCTTACATTCGCCTACTCTTCCACCACCCAGACCACCTGCTCCTTTGAATATGGTTA
TGGCTGTGTTCCCACTACCAGCTCGATCTCTTCTTCATCGACGACAACGACGACAACAACGTCTCCCTCCACATGGGTGC
CGCCCACGTATGGCACTACCTTCACACCCTATACCTCGTCTACCTCGTCGACATCCTCAACAACGACCACACCTGCAATC
CCGCCCTACTCTACGACGCCGTCTACAAGCACCACACACAAGACTACGAGCTGCACCATCAACTGGCCGCCGTCGTACAA
CATCACCACGGCATCAACTTTGACAAAGACGACAACGAATTTGGGCTACGGTGGCACAGTCACAACCTCGAAACCCAGTT
CCACCTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62