GenePrediction:GLEAN_214 Details

Name: GLEAN_214
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:276412..279424 (+ strand)
Length: 3013
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:276412..276456 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_167:276645..277078 (+ strand)
Length: 434
Type: CDS
Source: GLEAN
Position: GCSC_167:277164..278124 (+ strand)
Length: 961
Type: CDS
Source: GLEAN
Position: GCSC_167:278264..279424 (+ strand)
Length: 1161
>GLEAN_214 class=GenePrediction position=GCSC_167:276412..279424 (+ strand)
ATGTCGCTAATGAAATATAGCGGGCGCTGGAAAGACGACTCTGGCGTGTGTATTACCCGCTCTGCTACAGACATGCTCAG
TGGCTCAGGTTGCTAATCGCAGTTCACAGGTCAATGGTTATCGATTGGCTAGAGAATCAACGCACGCAAGCTGCCGTAAT
CTACCTATACTTCAGCTACAAAGAGGAGGAGGTTCAAACGTCTTTGAGTATGGTTGGAAGCTTACTAAAGTAGCTTATCC
AACGTCGAGCTGCTCTCCCGGATGACGTGCGCGACCTTTACAACCGTTACCTCAGGAATAGGACGCGTCCAGATCTGGAA
GTGCTTGCTCGGCTGCTCGAGCGAGAGGCGAAACTCTTACCAGTCTTTGTCGTGGTAGATGCTCTTGACGAGTGTCCTGA
ACGCAACAACACAAGGGATGAGCTGATCGCCGAGTTCCAAAAGCTGTCACAGAACGCACATGTCCTGATTACCTCTAGAT
ACTCTCAAAAGATCGAAAACAGTCTTGGAGGTTTCCCACAAATCGATATCAAAGCAACCGATGACGACGTTAGGCGATAC
GTCGAGGCACGCATTGAACAAAAGAAGTCGCTGTCAGGGCATGTCAGATCGACACCGTCACTAAGGGAGGAAATTTCCGA
GACCATCACTCGGAACTGTCAAGGAATGTACGCATATCTTCTCTTTACATGTCCCTCCTGTTTGTTTCGCCAAGTAATAC
CGTTCTCTCTAAATTTGTGACTTTTGGATTAGGTTTCTGCTTGCTCAGTTACACATGGACAGTCTGGCGAGAAAGTTGAA
TATCCGCGGCGTCCGAGCAGCATTGCGCAGCTTGCCTATAGAACTTGACGAGACCTACGAACAGGCGCTGCAACGGATAA
AAACCCTTGACGAGGAGAAAACTTCCCTAGCCTACAGAGTGTTATATTGGATTTCATATTCCTACCGGCCACTCACCGTT
GCGGAACTAAAGCACGCCTTGGCCACTGAGCCAGACGACGACGATCCCAACGACGATCTCGACGATGATTTCGACGAAGA
TGGCCTCTATGAAACGGATCTTATGGTGACGGTATGCGCTGGCCTGGTAACCGTGGACGAGGAAAGCAACCAGATCCGCC
TAGTGCACTACACAGCGCAGGATTACTTTGAGCGTATTCGCACGGGTCTGTTTCTCGGAGCACCTTCAACCATAGCCATG
ACCTGTCTGCGGTACTTGTTATTCAAACCGTTTTCTGAGATACATTGCTCAACCGAAGAGGAGCTCGCAGCACGCCTTGA
CAAATACCCATTTTTAGGGTACGCGGCCAGCTACTGGGGAGATCACATACGTGACGAAATGAACGACGATATCCGTAGGC
TTGCCCTAGAATATTTGGGCAACAGCATCCGCATCCTGAGTACCTATCAAGCGATCGACGAGGCAAAGCAGCTTCGACTT
TCCCCGATCAAAAGTATAAACTGTGGGAAAATCACCCGACTTCACGTCGCCGCCTTGTTCAATCTCGTCGATATTGCACG
AAATATACAAACAGGGTGGGCCGACGTTAATGCTAGAACGGACTGGGGTATGACACCACTCTATGTAGCGGCGGAGGCGG
GCCATACTCCAATGGTCGACTTCCTGTTGCAGGCAGGGGCAAATGTGGCATCCAAAAAAATCGGTGGCCTAACACCGTTG
CATATAGCCGCTCGAAATGGACACGAGCCTGTGGTAAGGCTTCTCATCGATGCCGGGGCAGACTGTAATGTCCGTGCTTC
AAGGGGGAAGTCGCCGCTCCACCTCGCAGCGGAGTATGGCCATATCGGCGTGGCGCAAGTTCTGATTAAAAAGGGAGCAA
AATGTCAATCAGAAAGACGCCGTGGCGTATGGCAGAAAGAGACTTGCCGACAAAGAGCCTTCTTCTCCCACACTAGATAA
AAACGACGAAATCAGAAACAGAGACAAGTCCGACTACGAGTCCGGCTACGAGGAGCTGGGCAGGACCCCGTTGAACCGCG
CTGCTGAAAAGGGTCACGATGCTTTGGTTCTCATGCTTCTAAACAATAAGGCCAACATATCTGCAACCGACGAAAAAGGT
CAGACGGCGCTCCATCAAGCCTCCCAAGCCGGTCACATCAAGGTTGTGGAGCACTTGATCGCTACAGGCATAGATGTCTT
GACCAGAGATGAAAGCGGTCAATCTGCGTTGCACTATGCGGCACGGACAGGTCAAGAAGCGATAATCAGAGTACTGATGC
AGAACAATGCAGACGTGCTAGCGGAGGACTTTGAGGGGAAAACAGCAGTTGACAAGGCTGCCATGAATGAACACGAGACT
GTCGTCAAGATACTGCTGGAGCACATGGGCAAGGAAGATGAGACTGAGCGATGGATAGCAACTGCGCTTCTCCGCCGTGC
AGTTGAGCAGGCAGACGAAGTCGAAGTCGACGCTCTATTGAGGAAGGGGGCAGATCCAAATGTGAGTGTCAAGTGGGACG
TCCCGCTTTTACACTTTGCCGTTACACGTGAGGATGCCGATGTGCTACAGCTCCTACTGGTGAATGGCGCCGATGTCGAC
ATAAAGGAGAGCTACGGCAGGACTCCTTTGCATTGGGCGGCCTATAGAGGCTACAGCACTGGTGTTCGGCTCTTGCTCGG
CCACGGCGCCGATATTCAAGCAGCCGATAACGATGGGGCAACACCACTGCATATGGCAACGGAATTTCATGGAAGTGCTC
TAGTGGTGGAGCAACTACTCCAGCACGGAGCACAACCAAATGCAAAAGACAGGAACGGAGAAACAGCCCTGTCGTGGTTG
TTCGGCTTAGGAATAGATGGGTGTATGCCTCTCATGGACGAGAAAGTCAGCCCCTTAACCCCCTGGACTGAAGACCGAAC
GGAAGATGATGAACAGAAGAGCGAACAGCAGGTCGAAGCCAAACAAGAGTCCAATCACCGTCTTGCCGTGCTTGATCTTC
TCATTCTAGCAGGGGCAGATCTAGATGCAAGCTATGCTTTGTTGTCACACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62