GenePrediction:GLEAN_2151 Details

Name: GLEAN_2151
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1087623..1088660 (+ strand)
Length: 1038
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1087623..1087714 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_108:1087822..1087869 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_108:1088092..1088275 (+ strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_108:1088343..1088660 (+ strand)
Length: 318
>GLEAN_2151 class=GenePrediction position=GCSC_108:1087623..1088660 (+ strand)
ATGTCTGACAGCGGCGAGATCGAGGTTGAGGCCGTCACCTACAAGGTCCTCCCGAAGGACATCACCGAGGAGGTCGGCTC
CATCAAGCTCTTGTACGGACACCGCAATCCCTCTTGTCTGAATGTGCTCTCTCGATTGCCTTGGGAGACTTGTCTGTAAA
ATTCAGCAATGCTAACTCGGCTTTTTCCCCGCGGCTTAGCAACAAGTGGTCCTACGACGATGTTGAGATCCGCGACATCT
CCCTCACGTAAGTTGCTGGCTCGGTGTTGGGTCTGCTTTCCCGTCCGAGGGACGGAGACGACGCGTTCTGGACACGGGAC
GAGGTATCCACGTTACTGGGCATCGTGCCAACCGACATCCTGTGGGCAGGCGCAACGAATCCGAGGTCCCTCGCAGCCGG
TCGAGGTCTACGACGATGGCAATGGGCCATGGTCATGCAGAGAGCTAACGTTCCCTTCTCTCTTCTCAGCGACTACATCC
AGATCCGCGCTCCCGTCTACCTCCCCCACTCTGCTGGCCGCTATGCTGCCAAGCGGTTCCGCAAGGCCAACTGCCCCATC
ATTGAGCGCCTCACCAACTCTCTGATGATGCACGGCCGCAACAACGGCAAGAAGCTCAAGGCTGTCCGCATTGTTGCCCA
CTCGTTCGAAATCGTATGTGTTTCCGGCTCTGGCCTCGTGATCGCCCCGCTCTTCAGATACTTACCTGCACCCTCTCCAG
GTTCACCTCATGACCGACCAGAACCCGATCCAGATTGCCGTTGACGCCATTGTCAACTGCGGCCCCCGCGAAGACTCCAC
CCGTATCGGCTCTGCCGGTACCGTCCGGAGACAGGCTGTCGATGTGTCGCCCCTGCGCCGCGTCAACCAGGCCATCTCTC
TGCTGACGACTGGTGCCCGTGAGGCGGCGTTCCGGAACGTCAAGACGATTGCCGAGTGCCTGGCTGAGGAGCTGATCAAC
GCCGCCAAGGGCAGCAGCAACTCGTACGCGATCAAGAAGAAGGACGAGCTGGAGCGTGTTGCCAAGAGCAACCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62