GenePrediction:GLEAN_2155 Details

Name: GLEAN_2155
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1109732..1112540 (+ strand)
Length: 2809
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1109732..1109851 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_108:1109913..1112540 (+ strand)
Length: 2628
>GLEAN_2155 class=GenePrediction position=GCSC_108:1109732..1112540 (+ strand)
ATGGCCGAGACGAGGATCAAGCAAACGCTGTTGGCTAGAACCAGGGCTGATGGCACCGTGCGGGCCCGCGCATACCATGG
GTACTCGCGCAACGGTTGTGCACGGTGCAAGCAGCAGCGGGTGAGTTCTTTCTTTTTCTTTTCTGGTGTACTTTTCCTTT
TTCCTTCTGACGCTTTCCCAGGTTCGATGTGATGAGCGCCACCCAGAGTGTAACCGCTGCGTACGGGTGGGCACCAAATG
CCCCGGCTATGAGCAGAAGCTGCGGTGGTCCGACAAGCACGAGGTGCTGCACAGCGTGGCCAATCCAGCCGCCGTCACCA
AGCCAGGCCCACCCCACGCTGCCAAGGTGACTGCTGCCGCGTTTAGGCCGTCGACCGAGCAGCTGCTGCAGATTATCCCG
GTCACGCCGGGGCCTCAGCCAGTCGCATCCCAAGTTCCAATTTCAGTCCCAGTTCCCGCACCATCTCCATCCGCCCTCTC
GGCACGTTCAGACCTCTCGGTACTATCACAGCAGCGGCCACAGCAGCGGTCGCGGTCGTCGTCGCCGCCGAATGACATGC
TAGAGACGTCGCCGGCCTCTCTGACGTCCTCGTCCGACACCAACGAGCTCCCAGCACTCGGTGGAGACGCTGTGACCGGC
CATATCTCGCTGCCCATTACAGCTCAACCGTCGGACAGCGCTGGGCAGAACGACGGCCACAGGTGGGACCCTGCCTATCT
CGACATGTTTGACCAGATGGACCCGGCCATTGCGTCAGATGTACCCGACTTCTACATGGGACTGGACAGTGCCTTTTTAG
CGGAGCGCAAGTCGCAGGGCACGGGCATGTTTCTGGGCGGCATGTTGTCTCTCGCCGACACGACAGCAGCAGCAGCAACG
CCGGCCGCACCAGCATCATATGCCGAGCCGCTGTCCACGGTGACCGGACTGTCCGGGCCGTCGATCCAGCATCAGCCGAT
GGCCACGCTCTTCTCGTCGCTGAGCGATGTCACCATCGACGACTTGTGGCGCGGCTGGTCACCAAAAATAGCGCCGCAAG
TTGTCGAATCGCCGGGCGTTGATCTGCAACCAAGCGGGATGGTGGCAGCCGCACAGCTGGACGACAGCGTACTGGTGGAC
GACGACGATTCGGGCGCGGACTTTTCCAGGAGCATTCCGGCAGCAGGAGGGTACGACGAGCCTCTGTCACCATACACGCT
GCCATCGCGGCGATCGAGCTCTTCGGTCTCGTATCAGGTGGCGCGGTCGCCATCGCCGCTGGCGCTGTCGATCAACGACA
TCGGCACGGTGCTGGTGGAGTTCTATTTCAAGGAGACAGCCAAGATCTACTCTTGCTACGACGGACGGATGAACCCGTTC
CGCACAACAGTGGTGCACCTATGGTCGTCGTCGGAGATTATCAACTGCACGGCGCAGAGCATGGCGGCCGGTTGTCTCCT
GCGTGACTTCCCACAGCTTGCGCCAGTAGGACGTCAACTGAGGCAGAAGGCGACGCGGATCCTGGCCAAGACCAAGACGT
GGGACACGAACACGATGCTGGCGGTGCTGATGCTGGGCGGCACAGCTAGCTGGCACGACAGCAAGGACCTCGGCCTGCCT
TTCTTCCAGCAGATCGCCGAGCGGCTCGCCATGGCACCGGCATCGGTATTTCGCGAAGGGGACAGCTGCAGGAACTATCG
TTTCTTCTACGAGTCGATGCAGTACTGGGAGATGCAGCTGGCCTTTTTGACCGAGGACGAGACGCTTCCGGGGACACCTG
ACTCCCACCTGCTGGCCGACCGGATCTTCGGCACCAGTTCGATCAGCCGGCAGCGAGAGCGAAACAGCTGGGCTGGAGAG
AGGGGCCAGCGACAGCGAGAGCAACAGCGACAGCGACAGCGGCAACAGCAACGCGAACAGGACAAAGACGAGGGCGGGCA
GGAGCCACTGCCACTGCCGCGACCACGGCCACCACCGACACCGCACCCGTGGACGGGCTTTGCAGGTGAGACGCAGCGGA
CGGTACAAAAGGTCGGGCGGCTGCTGCGACGGCAGCGCAAGTTTGACTTTGCACACCGGTTCGCATCGGTGGCACACATC
AGCCAGCTGCAGCAGGACATGCAGATGGCGCGGGAGCTGGAGGCGCACCTTCTAGGGATCTCACACCCGGCAGAGCACGC
GGTCAAGGACACGGAGGACGGCAACACGCCGGTGTGGCATCTGCTGACGCTGGCAGAACTCATAAGGCACATGGGGCTGA
TCCAGCTGTATCACGTGTTCCCGGACCTGCTGAGCGCGCGTTTGGGGCGTGAGCGGAGCGCCGGCAGCGGCAGCTACTAC
AACTTTGGGCTGGAGGCGGGCACAGCCATCACGCCGGCGCTGTGCCGGCGCTGGCTGACGACATACACGCTGCGCACGAT
GGACATGCTGCGGACGCTGCCGGTGGAATCGGGCACGCGGGTGTTCCAGCCGTTCTTGTTGGTGGCGCTGTCGAGCGAGT
TGCGGAATGCGGGTGGCGAGAATGGTGGACACAGCGGTCGGGCGTCGCTGTTGGGCCTCAATAAGGAGGCGGTCGAGGTG
GCCCGAGCACGCAGCTTCATCCACAGCCGACTGCAGCTGTTTTTGCACCTGCTGCCACCGAAACCGATGACGATGTGTGT
CAACATTGTGCAGGAGACGTGGGCGCAGATGGATCGGCAGGCCACGCTCCGGTCACTGGCCGTGGCCGGACAGGGCGTGG
GTAGGTGTCGGGCAGCGGCCGAGAGTGAGGCAGACGTGTACTGGATGGACGTCATGATTGAGAACGGCTGGGAGACAGTG
ATGGGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62