GenePrediction:GLEAN_2156 Details

Name: GLEAN_2156
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1112868..1115603 (+ strand)
Length: 2736
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1112868..1115603 (+ strand)
Length: 2736
>GLEAN_2156 class=GenePrediction position=GCSC_108:1112868..1115603 (+ strand)
ATGTATGCCCGGTACATACCGCCCAAGAAGACAGCGCCGGTGGCTGCACCGGCAGTTACACCGGCAGCCACACCAGCGGC
ATCTTTCGCCAGGGCTCTCCACAGCAATGCGCGCCATGCTCCCCCAGCAGTGGTGCAGCCGCCGCCGCCACCGCCGCCAC
AGAAGAGAAAGATTGTGTTTGATGACGACGACGATGTTGTGGCTTCTCCCTTTCAGGCTGCAGTGATCAGCAGTGCACAA
GACACTACAGCAGAGCGATCGGCAAAGCGGCTGAAGAAGGAGGCGAGAGAAGAGGTGGAACAGACTACGGCAGACGATGA
AGACAAGACGGCAAAGAAACGGAAACGTCGGAACAAGAAAGCCGGGAAGGAGAAGGACGGTGAAGAGGAGACGACAGAGG
ACTTGCCAAAAGCTGCGGACGAGGACACAGTGATGGCATCACCAGCACCGGCAGAGAAGGAGAAGAAGCGAAAGCGGAAG
CGCAAGTCCAAGGGGGCGAATGCAGAGGACGAGACCAGCGAACCAGCCGAGGCCGAAGAACAGAAGAAGCTCGAGGAAGC
AGGGCCAAAGGACGAGGTGAAGGAGAAGAAGAAGAAGAAGAAGCAGGAAGCAGCAGCAGCAGAAGATAATGAGGAGTCTG
CAGTGACAGCGAAAGAGGAGGCCGAGTTGCCAGACGAGAAGGAGATGCCAGTGCGATTCAAGGCGCTGCTGGAGAAGAAG
GAAAAGTCGCTGAAGCGGGCGAAGAAGCGGGCAGCCGAGGGGAGCGAAGAAGCGGTCACAGCAGCAGCAGCAGAAGGTGA
GGCAGAGGTGTCGTCACAGCCGCAGGAGCTGCACGGCCTAGAGCCGCTGCCGCAGCCGGAGCCGGTGGCAGCGGGAACGA
CGCGGCCGACGTACGACACGCAGCCACGGTGGCTAGCCGAGCCGGTGCGGGTGTCGGCCGACACGCGGGCATCATTTGGG
CAGCTGGGCATCGACGACGAGCAGGTGCAGCGCGTGCTGGCAGAGCGTGGCTGGACCGACGCCTTTGCGGTGCAGACAGC
GGTGATCCCGATGCTGCTGCCACCGTCGGCCGGCCAGCAGCGGCGTGGCGACCTGGTGATCTCGGCAGCGACGGGTTCGG
GCAAGACGTTGGCATATGTTCTGCCTCTGGTGCGGGATCTGAGTGGAGGTGGTAGCAGCCTGTCCGGACGACGGCTGCGG
GCCATCATCGTCGTGCCGACGCGCGAGCTGGTGCAGCAGGTGCACGACGTGTGCGAGACGTGTGCGCGGGCCTTCTCGGC
CGGCAGTGCGGGTGGACGGCGTGTGCGCATCGGTGCGGCCATGGGCAACCAGTCGCTGCGTCGCGAGCAGGCCGCCCTGG
TCGAGGAGGAGCAGGTCTACGACCCGGCGGGCTACCGGGCGGCGCTGCGTCGGCGACAGCGGTGGCCGTTGGTGGGAGCG
ACGGATGGCGGCAGCACGACCGACTGGACCGACTGGGTGTCCGAATCGACGTCGTCTGTCTTGTTGCCGGATCACGTGAT
CCGATACAAGTCCAGCGTCGACGTCCTCGTGACGACGCCCGGCCGTCTGGTCGAGCACCTCCGGTCGACGGCCGGCTTCG
CGCTCGACCACGTCCGCTGGCTGGTGGTCGACGAGGCCGACAAGCTGCTCGGCCAGAGCTACCAGCAGTGGCTGACGCAG
GTGCTGGGGCGTTTGGAGAGGCCAGGCAAAGCGCCGCTTGGCGCCCGCGACTTCTCGGATTCGGCCGAGAGCGGCGTGCG
CAAGGTCGTGCTCAGCGCCACGATGACGCGCGACCTCAGCAGCCTTGGCAGCCTGCGGCTGAGCCGGCCGCGGCATGTCG
TGCTCAAAGGCACGCGGCCGGACGGCGAGGACGGCATCCACAACAGCAGCGGTGCGGCCGAGTACGTGCTGCCGCGACGT
CTGCGCGAGTCGGCCGTCAAGGTGCGGGACGAGTCACAGAAGCCTCTGTACCTGGTGGACCTGCTGAACGACAGCGGACT
GATGGAGGTGATCAACGAGGGGGTGGAGGGGGGTGACGAGAGCAGCGAGGACGACAGTGACAGCAGCGACAGTGATGACT
CCAGCCACTCCAGCCGCTCCAAACCCACAAAGACCTTTGCCACGACGGCCCTCATCTTCACGCGATCCAACGAGAACGCG
CTGCGGCTGGCGCGTCTGCTGGCGCTGCTGCTGCCACCACAGCTGGCCAAGCTGGTTGGCACGATCACGTCGACGACGCG
GACGTCGGAGCGTCGTCGCACGCTGCGCGCTTTTGCGGCTCGGCAGCTGCGCATCCTCGTGGCGACCGACCTGGCAGCCC
GCGGCATCGATCTGGCGCAGCTCGATCACGTGATCAACTATGACATGCCGCCGAGCGTCGAGTTTTATGTTCACCGCGTC
GGTCGCACCGCGCGTGCCGGCCGGCCGGGTCACGCCTGGACGCTCTTCACGAAGAAAGAGGCCGGCTGGTTCTGGCCTGA
AGTGGCCGGCCAGGGCGGCAAGGCCGGCCGGACAGTCCTGTCGGTGGTGCGGCGCAGCGGCAAGGTGGCCAAGGTGGTGG
TGGGCGAGGAAGACGAGGAAGACGAGGACAGCGAGTCCGAAACGGAAACGGAGACCGAAACGGTCAGCGCCGGGCGGTTC
AGCAAGGCACGCATGGCCGCGTACGAGGCCGCGTTGGAGCAGCTCGGCAAAGAGGCGGCGGCCGAGCGCAACGGCGGAGG
CACAAAGAAGACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62