GenePrediction:GLEAN_2157 Details

Name: GLEAN_2157
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1115819..1119143 (+ strand)
Length: 3325
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1115819..1116300 (+ strand)
Length: 482
Type: CDS
Source: GLEAN
Position: GCSC_108:1116362..1117465 (+ strand)
Length: 1104
Type: CDS
Source: GLEAN
Position: GCSC_108:1117744..1117988 (+ strand)
Length: 245
Type: CDS
Source: GLEAN
Position: GCSC_108:1118095..1118203 (+ strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_108:1118256..1118805 (+ strand)
Length: 550
Type: CDS
Source: GLEAN
Position: GCSC_108:1118952..1119143 (+ strand)
Length: 192
>GLEAN_2157 class=GenePrediction position=GCSC_108:1115819..1119143 (+ strand)
ATGGCTCGCCGCACGTACAACATCGCCATGGTCAGCGACTTTTTCTTCCCGCAGCCGGGCGGGGTGGAGAGCCACATCTA
CCAGGTGTCGAGCAAGCTGGTGGACCGTGGCCACAAGGTGGTGATCATCACGCACGAGTATCCGGACCGCAAGGGCGTGC
GCTACCTGACGAACGGCATCAAGGTGTACTACGTGCCGTACTTTGTCATCTACCGCTCCACCACCTTCCCGACCGTCTTC
TCCTTCTTCCCCATGTTCCGCAACATCGTGCTGCGCGAGCAGATCGACATCGTGCATGGCCACGGAAGCCTCAGCAACCT
CTGCCACGAGGCCATCCTGCACGCCCGCACCATGGGCCTGCGTACCGTCTTCACCGACCACTCGCTCTTTGGCTTTGCCG
ACGCCACCAGCATCCTGGCCAACAAGCTGCTCAAGTTTTCGCTGAGCGACGTCGACCACGTCATCTGCGTAAGCCACACT
TGGTGAGTTGTGTGTTGTGTTGTGTTGTGTTGTCGTGTGGCTGATCGTATCTGTCTACACCAGCAAGGAGAACACAGTCC
TGCGCGCCTCGCTTGACCCCTTGATGGTCTCCGTCATCCCCAACGCCCTCGTGGCCGAGAACTTTATGCCGCTGGCCCAC
AACGGCGGCCCCAAAGGTCGAGACAAGCAACAGCAGCAGTCACCGCTGCCGGCACACCAGCTCGGCCCCGACGACCCCAT
CACGATCGTCGTCATCTCGCGCCTGTTCTACAACAAGGGCACCGACCTGCTGGTGGCGGCCATCCCGCGCATCCTCGCGA
GCCACCCGAACACGCGCTTCGTCATCGCTGGGTCCGGACCCAAGGCCATCGATCTGAAGCAGATGATCGAGCAGAACGTG
CTGCAGGACCGCGTCGAGATGCTCGGACCCGTCCGCCACGAAGAGGTGCGCGACGTCATGGTACGCGGCCATATCTATCT
GCACCCGTCGCTGACGGAGGCCTTTGGCACCGTCATCGTCGAGGCTGCCAGCTGCGGCCTCTACGTCGTCTGCACCCAGG
TCGGTGGCATCCCCGAGGTCCTGCCCTCACACATGACCGTCTTCGCCCGCCCGGAAGAGGACGACCTCGTGGCCGCCACC
GGCCGCGCCATCGCTGCCCTGCGCGCCAACAAGGTCCGCACCGAGCGCTTCCACGACCAGGTCCAGGCCATGTACTCGTG
GACCAACGTCGCCGCCCGCACCGAACGCGTCTACAACGGCATCACCGGCGCCATCACCGAGGCTGAGTTCTATGGGTACG
GCCTCAGCGGTGGTACGGCCAGCGCAGCCGGAGGTGCCGCCGGCGGCGGTGGTGGAAGCACGTCGACAGAGACCGCCACG
GCAGCAACCACGACGGCGGCTGCTGCCGCCACGGCTACCGCCTCGGCTCCGGCCAACGGCGGTTGGAGCGCCACGCGCGG
CCGCTCCGGCGTCCAGAGCTTCGCCCTCATCGACCGCCTCAAGCGCTACTACGGCTGCGGAATCTGGGCCGGAAAGCTCT
TCTGTCTCTGCGTCATCGTCGACTACCTGCTCCTCGTCTTTTGCGAGTTCTGGTGGCCGCGCGATCGCATCGACATCTGC
CCGGACTGGCCGCGCAAGACTCTGCCGCCCGACAAGGAGCCGAACAAGTGAGGCGCCGTCTCGGGATTGGATTGTCCTGC
TGACAGCAGGCGTCGTCAAAGGACTCCTTTTATACATGATATAACTCCGATGCTGGCTTGCAAAAGTCACGAAAGATTGA
TGCCCAACAGTCCATTCTCTGCCCGTCGCCCACTTTCCGAAGCAAAGCCTGTGTCAGATACGACTCGATATAAGTGAAGC
TCTCTTCTGTCTCTTGAATGCCTACAACGTCAATCTCGTCTAACATGGCCTTGACGACGGGAAACGCTACTCGGTCTACC
GGCAGGTCGGATGCGGCTCCAACTGCTACCACCGCGTCCGGCACCACTTTAGTTCAGAGCACGGTGGCAGACATTAATGC
CGTCCTCGACCTTCTGGGCCGCGGTGTCTCTGCAATCACGGGGCCTCTGAGCGGCTTCCGCGCCAACCGACAGCCAAGAA
ACGACCTCGGCGAGTGGGCGCATGAGGCGTTTGAGGGCGGCAGCTGGCGGCAGCTGGCGGCAGCCCGCCCTGCGCTGGGA
GAAGTTCGAGGTGCATCTGGCTACCGAGGAAGGCTGGGCTTTGCCTGACCGCAGAGATGTCTGCAAGTCGTTGTTTGAAT
GGGCGCGTCTCCTCCATGTGCTCAACATCCGCCCAGGACATGGCGCTGTCGACTGGGAGCTGCCATCTGCTGATTTCGAC
CCCCATGAGATGAGTCTCCATGTCGAGGGTCCGGTTCTCTGCCACATCATCAACCTCTACCGCCTGTACGAAGATGCCCA
ACCGACAGGCCTCACGAAAGCCAAGGGCCAACGCCAGCTCATCTTTGGGCGAATCTCGTTCCACGCTCTGGGTGCCGCCG
ACGGCCCAGAAGGCGCAGCCAGAGAAGGGCGGGGTCCGTTACGTCGCCTCGTTTCATCGCCAGAACCACATGAGCAACGA
AAAGCGAGTACGGCAGCTCTTCACGTGTCACTTCCCCCGCCGGACTCTGAGCATCGACTACCTCGACGTTCCGCCAAAGA
AGGTCATGAGTACGTACTACGACGCCGTCTTCCGTGACTTTTTTCTAGACGGTATCAACCTGCAGTCTAGGAGCGAGCTC
AAGGTGCGCGCCAAGGCACTATGCGATGCGTTTAAGTCTCCTAGAGGGGATTCCCCGCATATACTGACGCGGGCCTGGCT
GGAGGAGGCTTCCCGCAGCAAGCGCCGGATCACGATAGAGGGTGGCCGGAGCACAGTGCTGATCGACACAATCTGCGAGG
CACTGGAGCAGCAGCCTGCGTTCATCCAGGAAGCGGCAAGTCTGTACAGATTTAGTCTTCCGGACCTCCAGGAGGAGACG
GCGATAGAGGACCTCAATCAGGCTACAGTGGGCTGTATCAAGATGTTTCTCATGAGATGCTGCATGTTCAGCGACAACGC
AGGGCCTGACTCGTTCCCAGCTAAATACCACTTCCGACTCTTCTGGTCCGACGAGTCTTTATCCGGCACCGGATAGATTT
CCTCTATTCGCAGGCCACAGACGAGGTGGAAAGTGTGCTGCCTGAGCTGGCAGAGGACCCGGACTGGCCGCTGAGTGCTC
TGTTGTCGGACATGATCCCAGAGCTCATTTCGGTGCTCAAACTGTGCCATACGCTCCGAGGCCTGCCAGTCGTCGTCTTC
CAGCTAGACTGCGACCATGAGAAATGGGCGGAGCCTACTTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62