GenePrediction:GLEAN_2159 Details

Name: GLEAN_2159
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1130277..1131841 (+ strand)
Length: 1565
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1130277..1130460 (+ strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_108:1130523..1130677 (+ strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_108:1131242..1131841 (+ strand)
Length: 600
>GLEAN_2159 class=GenePrediction position=GCSC_108:1130277..1131841 (+ strand)
ATGAAATTTCTCAAGGCCGGCGGTACTGCTGTAGATGCCGTGGAGGTTGCCATCAAGAGCCTCGAAGACAGGGAAATTAC
CAATGCTGGCTACGGAAGCAACCTGACCATAGATGGAGTTGTGGAGGGTGACGCTACCATTGTCGACCATCTCGGTCGCA
GTGGTGCCTGCGGAGCAGTTCCGAGTGAGTTGCCTGTCCAGCGCCAAGGACGACTGTCCAGAACTGACATGAGGCTGCAC
ATGCAGTGATCAAAAATCCCATTTCGCTCGCCCGGCTCATCCTTGACCAGACCAATATTCCTCTGTCATTGCGCCGCATC
CCGCCCAACATTCTGGTCAGTGCGGGTGCACGGCGGTTTGCCGAGGAGCACGGAATGCGCACAGTGCCAAACGAGAAGCT
CGTATCGGAAGGGGCGCGGGCTCGCTTCGATCGGTGGCGGCACGAATTATATCGAGCCGAAGCAGCGACTTCTAGCACCC
ATCGAACAGCAATTGCCGATTCTACACGCCAAGGAAAGAGAACTCTGGCGGTGGCTAGCACACCTGAACTACAAGCAAGG
CCGGGCCAAACAACATCTAGTCAGCAACGGGAGCAAGAACAGCCGAGATCGGGACAGCTACTCGGTTCTAAAGGTGTTGA
CCCGGCAAAGATGCAAGATCCGACTTCTGTATTAAACATTGGCAACACGACTGGTCAGGCATCTACGCTTGGATTATCAA
CAACAGTACAACAGTCTGTCTCTGACCATTTTGAAGAGGCTTCCGGCGGTGCTACCGGTCCAGACAGGCAGCGACACACA
TCTACGGCTGACAGTGTGACATGGCCATCTCAGACGACGGCACCGCCTCCGAAACGACTTCGAATGGATAGGAACGAGCA
CACAATACGGAAGCGTGGCAGTAAAAGCAGTGTCGATGGTCATAGCGAAGCTCTGCCTCCAAATATACGACTTTCCACCG
AACAGGTCCATGAATCCGCCGAGTTCAAGGACGACAATTCAGACATCATCTCCGACACGGTGGGGGCCATAGCCGTCGAC
TTTCAGGGCAACATTGCTGCGGGCTCGTCATCTGGCGGCATCGGGATGAAACACAGTGGTCGAATGGGGCCAGCTGCTTT
GGTGGGGATCGGCACGGCCGTTCTGCCGGCTAACCCCAAGGACAAGATGGGAACGTCAGTGGCCGCGGTGACCAGCGGGA
CGGGCGAGCACATGGCTACAACGATGGCGTCGCATACCTGCGCAGAGCGGCTCTACTACAACATGCGAGTAGATGCAGGG
GGCTCTCCCGTGGCCGAGTACGACGACGACACACTGATGAAGACGTTTGTGTCGGAGGCTTTCATGGACCATCCGGGAGT
GAAGAACCAGGTCTCGGGAGGTGCGATAGGGGTGATGGCGGTGAAGAAGACATGCAAGGGCGTGTACTTCTATTTTGCAC
ACAATACCGACTCGTTTGCCCTTGCATCACTGTCGTCAAACGAAAAGGACCCTCTGGTGGTGATGTCGCGGCTGGGGTCT
CGAGAAAGTGTTGCACGGGGCGGCCGCAAGATCAAGAACAATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62